WWW.BOOK.LIB-I.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Электронные ресурсы
 
s

Pages:     | 1 || 3 |

«РАННИЕ МОЛЕКУЛЯРНЫЕ И КЛЕТОЧНЫЕ СОБЫТИЯ ФОРМИРОВАНИЯ МЕЗОДЕРМЫ У НЕРЕИДНЫХ ПОЛИХЕТ ...»

-- [ Страница 2 ] --

2.2. Манипуляции с живыми объектами Прижизненные наблюдения Для прижизненных наблюдений объекты в морской воде помещали между покровным и предметным стеклом с ножками из клейкой ленты. Чтобы предотвратить испарение воды, препарат запечатывали по контуру вазелиновым клеем или минеральным маслом. Для иммобилизации личинок химических агентов не применяли, высота ножек препарата подбиралась так, чтобы объекты оказывались немного прижатыми к стеклу.

Микроинъекции По протоколу Б. Бэкфиша (Backfisch, 2013) в зиготы P. dumerilii инъецировали растворы РНК и ДНК с помощью полуавтоматической системы, состоящей из микроманипулятора, инжектора и инвертированного микроскопа. Через 45 мин после оплодотворения культуру развития отмывали от слизистой оболочки, промывая через сито морской водой. Для размягчения желточной оболочки проводили обработку протеиназой К (50 мкг/мл в морской воде в течение 25 сек). После переваривания зародышей отмывали в 5 сменах свежей морской воды. Объекты загружали на предварительно сделанную агарозную подложку и контролировали микроманипуляции под 40х объективом. Раствор для инъекций содержал препараты очищенной ДНК и/или РНК, KCl (40 мM) и окрашивающий агент – TRITC-декстран MW 70 kDa (Invitrogen) (конечная концентрация – 0,6%) или феноловый красный (0,05%).

Перед инъекциями раствор центрифугировали 4 мин при 11000 rpm для осаждения частиц, способных закупорить микрокапилляры.

Инъекции осуществляли готовыми к использованию коммерческими капиллярами Femtotips II (Eppendorf). Инъекционное давление (pi) варьировало от 50 до 300 гПа, компенсационное давление (pc) выставляли около 10 гПа, так чтобы обеспечить незначительное подтекание раствора. Критичным для выживаемости зародышей были длительность и объем инъекции, которые следовало минимизировать.

Ингибиторный анализ Модуляцию MAP-киназного сигналинга проводили в растворе MEK-ингибитора U0126 (Promega) в период раннего развития A. virens – на стадиях дробления и начала гаструляции (Рис. 54 А). Все варианты эксперимента повторяли не менее 3 раз на партиях зародышей от разных родителей. Порошок U0126 растворяли в DMSO до концентрации 10 мM. Этот раствор хранили не более одного дня при -20°С. Финальная концентрация ингибитора в морской воде составляла 40 µM. Для удаления слизистой оболочки зародышей промывали через сито для клеточных культур с ячеей 40 µ кислой морской водой (pH ~4). Инкубацию с ингибитором или соответствующим количеством DMSO осуществляли в пластиковых чашках Петри в 6 мл раствора. Фиксации контрольных партий зародышей проводили в моменты начала и окончания действия U0126 в экспериментах (I)–(IV). На стадии ранней гаструлы (20 чпо) все объекты были отмыты от ингибитора в 6 сменах морской воды.

2.3. Молекулярно-биологические методы Дизайн праймеров Вырожденные праймеры подбирали к концам консервативных участков генов интереса вручную. Для этого последовательности гомологов гена выравнивали по алгоритму BLASTP, используя пептиды полихет и моллюсков в качестве запроса.

Выбранные аминокислотные области переводили в вырожденный нуклеотидный код.

Дизайн геноспецифичных праймеров проводили с помощью on-line сервиса Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/). Для RACE-ПЦР выбирали температуру плавления не ниже +65°С, обязательное наличие G или C на 3’ конце и наименьшую из возможных самокомплиментарность. Температуру плавления (Tm) определяли как параметр Melting Temperature (Salt Adjusted), выдаваемый on-line сервисом Oligo Calc (http://biotools.nubic.northwestern.edu/OligoCalc.html). Температуру отжига для ПЦР с HotStarTaq Plus ДНК-полимеразой (Qiagen) назначали на 3°С меньше Tm. В отсутствие удовлетворительного результата температуру отжига подбирали выше и ниже Tm, используя градиентную ПЦР.





Клонирование генов мРНК из зародышей или регенератов A. virens и P. dumerilii выделяли с помощью RNeasy Mini Kit – Purification of Total RNA from Animal Tissues (Qiagen) по протоколу производителя. Обратную транскрипцию проводили наборами Transcriptor High Fidelity cDNA Synthesis Kit (Roche) – для получения полноразмерной кДНК – и SMARTer RACE cDNA Amplification Kit (Clontech) – для получения 5’ и 3’ кДНК, используя входящие в наборы стандартные праймеры. Полученные библиотеки кДНК служили матрицей для амплификации фрагментов генов интереса.

Клонирование Avi-mox проводили в 2 этапа. Сначала с помощью вырожденных праймеров в ПЦР амплифицировали консервативный участок (часть гомеобокса), длиной 140 bp.

Праймеры:

mox_deg_up2 AARYTNGAYYTNAAYGCNAARCC (Tm=52–68°С, соответствует пептиду KLDLNAKP, степень вырожденности 4096);

mox_deg_lo2 ARRTCNARNGCNACNGCDATYTC (Tm=56–72°С, комплементарен последовательности, кодирующей пептид EIAVALDL, степень вырожденности 12288).

ПЦР смесь:

кДНК (полноразмерная) 1 µl 10х буфер (с 15 mM MgCl2) 5 µl dNTPs (10 mM) 2,5 µl праймер mox_deg_up2 (5 µМ) 1,5 µl праймер mox_deg_lo2 (5 µМ) 1,5 µl Taq ДНК-полимераза (Qiagen) 0,5 µl H2O 38 µl ИТОГО 50 µl ПЦР программа: 95°С – 5 мин, (94°С – 20 сек, 4245°С – 2 мин, 72°С – 30 сек)х10 циклов, (94°С – 20 сек, 47°С – 2 мин, 72°С – 30 сек)х35 циклов, 72°С – 10 мин.

Полученный ПЦР продукт анализировали с помощью электрофореза в агарозном геле, вырезали и выделяли из геля китом QIAquick Gel Extraction Kit (Qiagen).

Фрагмент 140 bp лигировали в вектор, трансформировали бактериальные клетки, проверяли выросшие на селективной среде клоны в ПЦР с праймерами М13, комплементарными векторной части плазмиды. Клоны со вставкой инокулировали в ночную культуру, выделяли из них плазмидную ДНК и отправляли ее на секвенирование с праймером М13.

На следующем этапе в тачдаун-ПЦР амплифицировали 5’RACE-фрагмент Avimox.

Геноспецифичный праймер: Nvi-mox_lo1 CCTCCGGAGTCTGGTCAAGTAGTTATGC (Tm=72°С).

ПЦР смесь:

5’ кДНК (разведенная 1:25) 5 µl 10х буфер (с 15 mM MgCl2) 2,5 µl MgCl2 (25 mM) 0,5 µl dNTPs (10 mM) 1 µl праймер 10х UPM 2,5 µl праймер Nvi-mox_lo1 (5 µМ) 2,5 µl Taq ДНК-полимераза (Qiagen) 0,4 µl H2O 10,6 µl ИТОГО 25 µl ПЦР программа: 95°С – 5 мин, (94°С – 30 сек, 7265°С – 1 мин, 72°С – 4 мин)х20 циклов, (94°С – 30 сек, 63°С – 1 мин, 72°С – 4 мин)х30 циклов, 72°С – 10 мин.

Полученный фрагмент Avi-mox длиной 958 bp (frkt#1292) клонировали, как описано выше для консервативного участка.

5’RACE-фрагменты Avi-piwi1 (перекрывающиеся pi-6, 854 bp и pi-49, 1650 bp), Avievx (rk322, 772 bp), Pdu-evx (frkt#1287, 912 bp), 3’RACE-фрагменты Avi-evx (frkt#1293, 1743 bp), Pdu-twist (frkt#1288, 1875 bp) амплифицировали, как и Avi-mox (frkt#1292), в тачдаун-ПЦР. Праймеры подбирались исходя из известной последовательности клонированного ранее консервативного участка (для A. virens) или по последовательностям из геномной и транскриптомной базы данных http://4dx.embl.de/platy (для P. dumerilii). Для Pdu-mox обширный фрагмент кодирующей области (CDS) был выделен не в RACE-ПЦР, а в ПЦР с двумя геноспецифичными праймерами.

Праймеры:

pi_168_5R4 GGCTTGGTGACTACGGTGTCTACTATTG (Tm=70°С);

#2253 nested_pi6_lo CAATGCTTTCTGCTCATCACGGCC (Tm=67°С);

Nvi-evx_up1 GATGAACGTCGAATGGGCCACGG (Tm=68°С);

ev_286_5R2 GCGGCCAATTCGCATCTTCGTG (Tm=66°С);

Pdu-evx_lo1 GGTCTGAGATTCCGTAGGGCCAAGC (Tm=71°С);

#2328 Pdu-twi_ex1_up1 CTCGACTGGATTACTGCTAACG (Tm=62°С);

Pdu-mox_up2 CGGGGCCTTTGCATCACTACC (Tm=65°С);

Pdu-mox_lo2 TCTTTCAATTGGTCTTTGTCCTCCATTG (Tm=66°С).

Секвенирование и анализ последовательностей Секвенирование плазмид и ПЦП продуктов по Сэнгеру производилось коммерческими организациями (LGC Genomics, Microsynth AG) или в РЦ СПбГУ.

Секвенирование ДНК из BAC-клонов осуществлялось в центре Genoscope по методу 454 Life Sciences/Roche.

Рутинный анализ последовательностей ДНК, РНК и белков проводили в программах CLC Main Workbench (Qiagen), BioEdit (Ibis Biosciences), ApE (A plasmid Editor). Для выравнивания кДНК и гДНК использовали on-line сервисы SIM4 (http://pbil.univ-lyon1.fr/members/duret/cours/inserm210604/exercise4/sim4.html) и Splign (https://www.ncbi.nlm.nih.gov/sutils/splign/splign.cgi). Предсказание ORF генов в гДНК осуществляли алгоритмами FGENESH (http://www.softberry.com/berry.phtml) и Augustus (http://bioinf.uni-greifswald.de/augustus/). Для выравнивания геномных локусов и поиска консервативных участков некодирующей гДНК (Evolutionary Conserved Regions – ECR) использовали портал Mulan (https://mulan.dcode.org/).

Наличие консервативных мотивов в UTR мРНК проверяли сервисами REPFIND (http://zlab.bu.edu/repfind/form.html) и UTRSite (http://utrsite.ba.itb.cnr.it).

Аннотирование белковых последовательностей проводили по базам данных Pfam (http://xfam.org/) и PROSITE (http://prosite.expasy.org/).

Филогенетический анализ проводили на сервере Phylogeny.fr (www.phylogeny.fr). Для этого клонированные и секвенированные фрагменты генов интереса транслировали в аминокислотные последовательности и предварительно определяли их принадлежность к генетическому семейству, используя BLASTP.

Полученные в результате наборы ортологов выравнивали по алгоритму MUSCLE 3.7 с параметрами определения G-блоков по умолчанию. По G-блокам методом максимального правдоподобия PhyML 3.0 с aLRT-тестом строили филогенетическую схему. Изображения дендрограмм получали в TreeDyn 198.3.

Идентификация клонов в геномной ВАС-библиотеке и аннотация генных локусов Геномная BAC-библиотека для A. virens была произведена в фирме Bio S&T в 2008 г. (образцы # QUO03409 и # QUO03587). Тип вектора этой библиотеки – pIndigoBAC-5, сайт клонирования – HindIII, средний размер вставки – порядка 100 kb.

Совместно с Ф. Райбле в этой библиотеке с помощью радиоактивной саузернгибридизации было найдено от 5 до 12 клонов, позитивных по зондам к генам Avitwist, Avi-vasa, Avi-pl10, Avi-piwi1 и Avi-piwi2, протяженные 3’- и 5’RACE фрагменты которых были ранее клонированы Р.П. Костюченко. Автором была проведена дальнейшая проверка клонов и выбор по 1 клону для каждого гена для отправки на секвенирование. Для этого клоны были высеяны на агаровые чашки, по 3 колонии были инокулированы в жидкую культуру, из которой выделяли BAC-ДНК. Препараты ДНК были подвергнуты рестрикции (2 ч при +37°С) с EcoRI, HindIII и EcoRI+HindIII (Fermentas) после чего – фракционированы в 0,8% агарозном геле. Для дальнейшего Саузерн-блоттинга гель помещали в денатурирующий раствор (1,5 M NaCl, 0,5 M NaOH) на 40 мин и в ренатурирующий раствор (1,5 M NaCl, 0,5 M Tris-HCl pH 7,4) на 20 мин, а затем монтировали конструкцию для блоттинга. Под гель помещали фильтровальную бумагу, концы которой опускались в резервуар с 10x SSC, сверху на гель клали нейлоновую мембрану (Peqlab), а на нее – несколько слоев фильтровальной бумаги и бумажные салфетки, на самый верх сэндвича помещали груз. После переноса ДНК из геля на мембрану в течение ночи блот разбирали, ДНК сшивали с мембраной в УФизлучении при помощи режима “auto-crosslink” в аппарате UV-crosslinker и оставляли мембрану высохнуть на 2 ч.

Для Саузерн-гибридизации готовили радиоактивно меченные зонды. Из плазмид rk155, rk242, rk236, rk139, rk263, rk229, rk230, rk232 рестриктазой EcoRI вырезали вставки с фрагментами генов Avi-twist, Avi-vasa, Avi-pl10, Avi-piwi1 и Avi-piwi2.

Выделенные из геля линейные фрагменты ДНК в количестве 100 нг добавляли в реакцию синтеза зондов, собранную из набора RadPrime DNA Labeling System (Invitrogen). Мембраны с BAC-ДНК промывали в 2x SSC и предгибридизовали в Rapidhyb Buffer (GE Healthcare Amersham) при +65°С 30 мин. Зонды добавляли в буфер и оставляли для гибридизации при +65°С на ночь. После отмывок мембраны в 2x SSC+0,1% SDS и 0,2x SSC+0,1% SDS (по 2 раза 20 мин при +65°С) сигнал проявляли на фосфорной пластинке (GE Healthcare) с экспозицией 1–2 дня. Все манипуляции с радиоактивными материалами были проделаны Ф. Райбле. После проявки авторадиографически помеченные полоски на мембране сопоставляли с фрагментами на геле и определяли их длину. По 1 BAC-клону с наибольшим суммарным размером фрагментов, кодирующих гены интереса, было отправлено на секвенирование. Их координаты в BAC-библиотеке: 69M19 (содержит локус Avi-twist), 91A1 (Avi-vasa), 94H8 (Avi-pl10), 109A1 (Avi-piwi1), 87P17 (Avi-piwi2).

Полученные после секвенирования каждого из клонов данные состояли из различного числа контигов (от 5 до 19 шт) длиной от 0,1 до 52 kb. На этих контигах были картированы известные по кДНК последовательности генов интереса. Для дальнейшего анализа требовалось установить наличие достаточного по длине участка “выше” (up-stream) от точки начала транскрипции, поскольку именно в 5’ области от транскрибируемой последовательности могут быть расположены цис-регуляторные элементы. В первоначально полученных контигах искомые участки составляли 0,5 kb у Avi-pl10, 1,3 kb у Avi-vasa, 1,5 kb у Avi-piwi2, 1,7 kb у Avi-piwi1, 11,4 kb у Avi-twist. Для увеличения размеров этих областей и восстановления последовательностей между контигами использовали ряд подходов: секвенирование BAC по Сэнгеру, сравнение с последовательностями из базы данных генома P. dumerilii и предсказание CDS в гДНК in silico с последующей ПЦР со специфическими праймерами и секвенированием продуктов, TAIL-ПЦР (Thermal Asymmetric Interlaced PCR). В результате нам удалось реконструировать протяженные последовательности BAC-клонов, содержащие полные локусы генов интереса, включая участки не менее 5 kb up-stream от точки начала транскрипции. Для Avi-vasa длина соединенных в правильном порядке контигов составила 50 kb из 83 kb (общей длины гДНК, содержащейся в просеквенированной BAC), для Avi-pl10 – 23 kb из 110 kb, для Avi-piwi1 – 33 kb из 150 kb, для Avi-piwi2 – 83 kb из 83 kb, для Nvi-twist – 24 kb из 141 kb.

ВАС-рекомбинация Модификация клона 69M19, содержащего локус гена Avi-twist, была выполнена по протоколу BAC-рекомбинации (Ejsmont et al., 2009). В результате в эндогенную рамку считывания Avi-twist была встроена репортерная кассета, кодирующая eGFP и нитроредуктазу (NTR) (Рис. 14, 15).

Эту кассету амплифицировали с плазмиды pR6KE2N-FRT (frkt#894) с праймерами, которые содержали на 5’ конце некомплиментарные матрице участки в 50 bp, соответствующие фланкам интеграции в BAC:

#2233 Nvi-twi_locus_HA1_eGFP_cassette_ATG+6aa_fus_up (Tm=68°С) tgtggtttgagccctcttcgctggattaaatgagtgttatggtacctgagATGGTGAGCAAGGGCGAGGAGC #2234 Nvi-twi_locus_HA2_eGFP_cassette_exon1_75-124bp_lo (Tm=62°С) catgatgagggccggagttcgaagttgctgctgattgtggatgttgtttcTAACAGATGAGGGCAAAGCGCT ПЦР программа: 98°С – 1 мин, (98°С – 10 сек, 62°С – 30 сек, 72°С – 2 мин)х30 циклов, 72°С – 5 мин.

Рис. 14. Принцип ВАС-рекомбинации для создания репортерного трансгена. В кодирующую область гена интереса (синий блок CDS) внедряется последовательность зеленого флуоресцентного белка GFP. Остальные области генетического локуса остаются неизмененными, что обеспечивает полноту контекста, регулирующего экспрессию трансгена.

Рис. 15. Генетические конструкции для ВАС-рекомбинации. А – строение репортерной кассеты pR6K-E2N-FRT. Б – амплифицированная кассета с фланками интеграции (hm) длиной 50 bp. В – плазмида pRedFlp4, обеспечивающая экспрессию системы белков рекомбинации Red/ET. Г – целевая ВАС, в которую встраивается репортерная кассета. Д

– рекомбинантная ВАС.

Продукт реакции длиной 3,6 kb после электрофореза выделяли из агарозного геля и использовали для трансформации BAC-клона. Бактериальные клетки клона 69M19 предварительно трансформировали плазмидой pRedFlp4 (frkt#893) и индуцировали экспрессию системы белков рекомбинации Red/ET добавлением в среду L-рамнозы. Все трансформации проводили путем электропорации в 2 мм кюветах (BioRad) с параметрами 2500 V, 25 F, 250 Ohm. Трансформированные клетки отбирали на агаровых чашках с селективной средой. Корректность рекомбинации проверяли с помощью ПЦР на колониях.

Использовали 2 пары праймеров, один из которых соответствовал фланкирующей области сайта интеграции, а второй распознавал последовательность в кассете pR6K-E2N-FRT:

#2239 Nvi-twist_locus_HA1_control_up AATGAGTGTGAAGTATGGCTGC (Tm=60°С);

#1746 eGFP_pR6K-E2N-FRT_HA1_control_lo GCAGCTTGCCGGTGGTGC (Tm=63°С);

#1747 neo_HA2_control_up Tm = 60 GGCTACCCGTGATATTGCTG (Tm=60°С);

#2240 Nvi-twist_locus_HA2_control_lo TTCTTGCGCTTCCGACTGCC (Tm=62°С).

У рекомбинантных клонов ангидротетрациклином индуцировали экспрессию флиппазы, которая выщепляла из репортерной кассеты ген rpsLneo, определяющий устойчивость к антибиотику. Бактериальные клетки высевали на агаровые чашки и проверяли колонии в ПЦР с праймерами #2239 Nvi-twist_locus_HA1_control_up и #2240 Nvi-twist_locus_HA2_control_lo.

Следующим шагом по созданию наследуемого в череде поколений трансгена было введение в векторную область BAC кассеты с последовательностями транспозонов, обеспечивающих интеграцию трансгена в геном хозяина. Для этого использовали кассету с транспозонами Tol2. По аналогии с первым этапом рекомбинации с помощью ПЦР на плазмиде piTol2-kan (frkt#979) получали линейную

ДНК, фланкированную последовательностями праймеров:

#2238 Nvi_pIndigoBAC_HA1_piTol2_up2 (Tm=63°С) ttctctgtttttgtccgtggaatgaacaatggaagtccgagctcatcgctCCCTGCTCGAGCCGGGCCCAAGTG #1739 Nvi_pIndigoBAC_HA2_piTol2_lo (Tm=63°С) agccccgacacccgccaacacccgctgacgcgaaccccttgcggccgcatAATTCATTATGATCCTCTAGATCA GATCT Данной кассетой трансформировали BAC-клон с индуцированной экспрессией Red/ET. Отобранные с агаровой чашки колонии проверяли в ПЦР с 2 парами праймеров:

#1750 Nvi_pIndigoBAC_HA1_control_up GGCGTTTCCGTTCTTCTTCG (Tm=60°С);

#1752 piTol2_HA1_control_lo GGGTAGGGGGTCAAGAACC (Tm=62°С);

#1751 Nvi_pIndigoBAC_HA2_control_lo GAATGGCGCCTGATGCGG (Tm=61°С);

#1753 piTol2_HA2_control_up GGTACCGGCATATGGTTCTTG (Tm=61°С).

BAC-ДНК выделяли после каждого акта перестройки и подвергали рестрикции с EcoRV и XhoI, чтобы подтвердить целостность рекомбинантной BAC (Рис. 43).

Корректность интеграции введенных кассет в итоговой BAC была проверена с помощью секвенирования продуктов контрольных ПЦР, содержащих сайты интеграции. Таким образом, была получена готовую генетическую конструкцию pTol{Avi-twist::eGFP-F2ANTR}. Для микроинъекций BAC-ДНК была выделена с помощью набора EndoFree Plasmid Maxi Kit (Qiagen) и хранилась при +4°С.

Проверка активности транспозазы Mos1 in vivo pCS2+Mos1frkt574 Для получения мРНК транспозазы Mos1 плазмиду линеаризовали рестриктазой NotI-HF (NEB), проверяли электрофорезом, вырезали и выделяли из агарозного геля и использовали в качестве матрицы для транскрипции in vitro. Синтез РНК ставили на ночь при +37°С, используя набор mMESSAGE mMACHINE Sp6 Kit (Ambion). РНК выделяли набором RNeasy Mini Kit – RNA clean up (Qiagen), проверяли качество продукта электрофорезом, делали аликвоты и хранили при -80°С.

В зиготы P. dumerilii инъецировали плазмидную ДНК вектора-донора pMos{rps9::egfp}frkt1074 (С=200 нг/мкл) с или без мРНК транспозазы (С=200 нг/мкл). Через 4 ч после микроинъекций зародышей проверяли на наличие флуоресценции TRITC и переваривали протеиназой К (2 ч при +56°С).

Лизат использовали в ПЦР с праймерами, комплементарными векторной области и отстоящими от границ транспозона на 542/223 bp:

#1309 M1f CCCTCACTAAAGGGAACAAAAGCTTTATGG (Tm=69°С);

#2254 M1r CTTGCATGCTCCGCTGTTTTGTCAGTG (Tm=70°С).

ПЦР смесь:

лизат из зародышей 2 µl 10х CL буфер (с 15 mM MgCl2) 2 µl dNTPs (10 mM) 0,8 µl праймер #1309 M1f (5 µМ) 1 µl праймер #2254 M1r (5 µМ) 1 µl Taq ДНК-полимераза (Qiagen) 0,25 µl H2O 12,95 µl ИТОГО 20 µl ПЦР программа: 95°С – 5 мин, (95°С – 30 сек, 69°С – 30 сек, 72°С – 1 мин)х35 циклов, 72°С – 10 мин.

По 1 мкл продукта реакции использовали в качестве матрицы для гнездовой ПЦР (состав реакции идентичен первой ПЦР, в программе отличалась температура отжига – 67°С).

Праймеры для гнездовой ПЦР отстояли от границ транспозона на 245/96 bp:

#2255 M1nf TGACCATGCGCACTTCCACTTTCGTG (Tm=70°С);

#2259 M1nr GAGCGAACGCAGACGAGTAAAACG (Tm=67°С).

Полученные ампликоны анализировали электрофорезом в агарозном геле (Рис.

40 В), вырезали, выделяли и лигировали в вектор.

Генотипирование по Pdu-twist Определение последовательностей Pdu-twist, присутствующих в популяции культивируемых в лабораторных условиях P. dumerilii, проводили с помощью ПЦР на гДНК червей (по 3 образца из инбредных линий PIN, VIO, FL2). Праймеры подбирали к границам экзонов, определенным после аннотирования локуса Pdu-twist из геномной базы данных по клонированной кДНК.

Праймеры:

#2328 Pdu-twi_ex1_up1 CTCGACTGGATTACTGCTAACG (Tm=62°С);

#2329 Pdu-twi_ex1_lo1 ATATCAGTGGCCGTTGACTCC (Tm=61°С);

#2330 Pdu-twi_ex2_lo1 TGGTCCAAGATCAGAAGACACC (Tm=62°С);

#2432 Pdu-twi_ex1_lo2 GAGGGTGGGGATGATCTTTCTG (Tm=64°С).

ПЦР смесь:

ДНК 1 µl 5х HF буфер (с 7,5 mM MgCl2) 5 µl dNTPs (10 mM) 0,5 µl праймер #2328 (5 µМ) 2,5 µl праймер #2329 или #2330 (5 µМ) 2,5 µl Phusion ДНК-полимераза (NEB) 0,25 µl H2O 13,25 µl ИТОГО 25 µl ПЦР программа: 98°С – 1 мин, (98°С – 10 сек, 62°С – 1 мин, 72°С – 3 мин)х35 циклов, 72°С – 5 мин.

Для амплификации первого экзона использовали пару праймеров #2328 и #2329, для получения первого экзона, интрона и начала второго экзона – #2328 и #2330. Ампликоны из реакций с образцами PIN и VIO клонировали и подвергали рестрикции с HinfI. После секвенирования и выравнивания в последовательности первого экзона определяли полиморфные позиции SNP.

Для генотипирования области первого экзона Pdu-twist, в которой искали TALENиндуцированные indel-мутации, использовали ПЦР, в норме амплифицирующую фрагмент длиной 483 bp. В качестве матрицы использовали лизированные протеиназой К (2 ч при +56°С) личинки или ампутированные задние концы тела ювенильных червей.

ПЦР смесь:

лизат 2 µl 10х CL буфер (с 15 mM MgCl2) 2 µl dNTPs (10 mM) 0,8 µl праймер #2328 (5 µМ) 0,8 µl праймер #2432 (5 µМ) 0,8 µl Taq ДНК-полимераза (Qiagen) 0,12 µl H2O 13,48 µl ИТОГО 20 µl ПЦР программа: 95°С – 5 мин, (94°С – 20 сек, 60°С – 45 сек, 72°С – 30 сек)х35 циклов, 72°С – 5мин.

Для выявления в полученном ампликоне мутаций, затрагивающих спейсерную область между сайтами связывания сконструированных TALEN twi-2L и twi-2R или twiL и twi-3R, ставили рестрикцию с BamHI (NEB) – 2 ч при +37°С. В случае рестрикции ампликона 483 bp из аллелей Pdu-twist А и В дикого типа образуется 2 фрагмента длиной 315 bp и 168 bp.

Состав реакции:

рестриктаза BamHI (NEB) 0,5 µl 10х буфер № 4 (NEB) 1,5 µl продукт ПЦР реакции 8 µl H2O 5 µl ИТОГО 15 µl По 8 мкл ПЦР реакции до и после рестрикции загружали в соседние лунки агарозного геля и анализировали электрофорезом (Рис. 50). Присутствие на дорожке с рестрикцией непереваренного фрагмента длиной около 0,5 kb свидетельствовало о произошедшей мутации. Такие ампликоны вырезали, выделяли из геля, клонировали и секвенировали.

Дизайн и клонирование сайт-специфических нуклеаз TALEN Transcription activator-like effector nucleases (TALENs) являются синтетическими белками, которые состоят из набора ДНК-связывающих доменов с вариабельными двумя аминокислотами – Repeat Variable Diresidue (RVD), отвечающими за распознавание одного из нуклеотидов, и нуклеазного домена FokI (Рис. 16). Белки TALEN связываются со специфическим участком ДНК (он определяется набором RVD) и действуют в паре, так что при димеризации нуклеазных доменов они вносят в ДНК двунитевой разрыв. Внутриклеточные системы репарации восстанавливают целостность ДНК, но в отсутствие матрицы механизм NHEJ приводит к случайным делециям и инсерциям (indel-мутациям) в области спейсера – между сайтами связывания TALEN (Рис. 16). Сконструировав TALEN для кодирующей области гена, можно добиться генетического нокаута за счет сдвига рамки считывания после репарации или крупной делеции ДНК, кодирующей функциональный домен.

Рис. 16. Строение и принцип работы TALEN. А – позиционирование пары белков TALEN на последовательности-мишени за счет ДНК-связывающих доменов. Димеризация нуклеазных доменов Fokl обеспечивает двунитевой разрыв ДНК в области спейсера. Б – репарация двунитевого разрыва. В отсутствие матрицы для восстановления первоначальной последовательности indel-мутации возникают за счет негомологичного воссоединения концов (NHEJ) – синяя стрелка. При наличии ДНКдонора теоретически возможна репарация по типу гомологической рекомбинации – красная стрелка.

Дизайн TALEN подбирался с помощью on-line сервиса TALEN Targeter (https://tale-nt.cac.cornell.edu/node/add/talen), куда загружали 5’ область первого экзона Pdu-twist до начала последовательности, кодирующей bHLH домен. Пары TALEN выбирали из предложенного списка с тем, чтобы их длина составляла от 12 до 20 ДНКсвязывающих доменов, эти домены содержали как можно больше RVD HD, распознающих цитозин, и как можно меньше – RVD NN, связывающий гуанин.

Отвергались сайты TALEN, заходящие на выявленные SNP. Cпейсерная область должна была содержать сайт рестрикции, разделяющий ампликон 483 bp для генотипирования (см. выше) на отличимые фрагменты при скрининге мутаций. Подобранные TALEN (картированы на Рис.

49) имели следующие последовательности RVD:

twi-1L HD NI NN HD HD NI NN NG NN HD NG HD HD NN NG HD (16 RVD);

twi-1R NN HD NI NN NN NN HD NN HD NG HD NI NG NN NN NG (16 RVD);

twi-2L HD NI NN NN NI NG NN HD NI NN HD NN NI HD NI NN (16 RVD);

twi-2R HD HD NN HD HD NI HD NG NG HD HD NN NG (13 RVD);

twi-3L HD NI NN NN NI NG NN HD NI NN HD NN NI HD NI NN HD (17 RVD);

twi-3R HD HD NN NI NN NI NG HD HD NN HD HD NI HD NG NG HD (17 RVD).

Клонирование этих TALEN из набора плазмид с последовательностями отдельных RVD производили по опубликованному протоколу (Cermak et al., 2011) из набора Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene). Конечными экспрессионными векторами, содержащими гетеродимерный FokI служили pCS2TAL3DD и pCS2TAL3-RR (Addgene). Корректность последовательности RVD проверяли секвенированием.

Для получения мРНК TALEN плазмиды (2–5 мкг) линеаризовали рестриктазой NotI-HF (NEB), проверяли электрофорезом, вырезали и выделяли из агарозного геля и использовали в качестве матрицы для транскрипции in vitro. Синтез РНК ставили на 3 ч или на ночь при +37°С, используя набор mMESSAGE mMACHINE Sp6 Kit (Ambion). РНК не выделяли, а лишь проверяли качество продукта электрофорезом, делали аликвоты и хранили при -80°С. Конечная концентрация мРНК TALEN в растворе для микроинъекций составляла от 100 до 400 нг/мкл.

TAIL-ПЦР Протокол TAIL-ПЦР (Thermal Asymmetric Interlaced PCR) был получен лабораторией Ф. Райбле от Я. Сасакура (Sasakura et al., 2003). TAIL-ПЦР представляет собой 3 последовательные полугнездовые ПЦР, способные амплифицировать участок ДНК лишь с одним заданным концом. К этому концу апликона подбираются 3 последовательных (гнездовых) праймера. Второй конец ампликона лежит в области с первоначально неизвестной последовательностью ДНК.

Этот конец определяется отжигом одного из вырожденных праймеров:

#98 TailN-1 NGTCGASWGANAWGTT #99 TailN-2 GTNCGASWCANAWGTT #100 TailN-3 WGTGNAGWANCANAGA #101 TailN-4 NGTCGASWGANAWCTT #102 TailN-5 GTNCGASWCANAWCAA #103 TailN-6 WGTGNAGWANCANTCT #104 TailN-7 NGTCGASWGANAWAGA #105 TailN-8 WGTGNAGWANCANGTT С каждым вырожденным праймером ставили серию ПЦР со следующими специфическими праймерами (…_TAIL1, _TAIL2, _TAIL3):

Праймеры в области левого инвертированного повтора транспозона Mos1:

#2274 MosL_TAIL1 GGCACGAAACTCGACATGTTGACTGC #2275 MosL_TAIL2 AACAATTATGACGCTCAATTCGCGCC #2276 MosL_TAIL3 GGTGGTTCGACAGTCAAGGTTGACACTTC Праймеры в области вектора-донора за пределами левого инвертированного повтора транспозона Mos1:

#2277 MosL_vec_TAIL1 AAACTGCTCGAAGAACTCCAATCTG #2278 MosL_vec_TAIL2 TGCCTGGTCATTGTTTACATTTAGCTC #2279 MosL_vec_TAIL3 CCATACACACCCATGTGTAGATAAAG

Праймеры в области правого инвертированного повтора транспозона Mos1:

#2280 MosR_TAIL1 AGCGCTTCGATTCTTACGAAAGTGTG #2281 MosR_TAIL2 GGTTCGCCGCAAAAGACGATGAGTTC #2282 MosR_TAIL3 GGAATCCACAAATTGCCCGAGAGATGG Праймеры в области вектора-донора за пределами правого инвертированного повтора транспозона Mos1:

#2283 MosR_vec_TAIL1 CACCGACTGGAGCCCGTACTGTG #2284 MosR_vec_TAIL2 CCACGAAAGTGGAAGTGCGCATG #2285 MosR_vec_TAIL3 GGGAACTGCTAGCACGCAGTG

Праймеры в области BAC-клона 94H8 у 5’ конца локуса Avi-pl10:

#2314 N94H8Nvi-pl10_TAIL1 CTCCCCTACTCCTCCCTCAGAC #2244 N94H8Nvi-pl10_TAIL2 CCACCTCGAATAGAAGCCTTTCAG #2313 N94H8Nvi-pl10_TAIL3 TTCAATTGAGGGAGGGCCTTTATTC

Праймеры в области BAC-клона 109A1 у 5’ конца локуса Avi-piwi1:

#2315 N109A1Nvi-piwi1_TAIL1 TGGCATCCTGCAATGCCTAATTTTG #2265 N109A1Nvi-piwi1_TAIL2 GGCTGCAGTGGTGGTGTTGGTG #2258 N109A1Nvi-piwi1_TAIL3 GGGACCATGGCAATGAGATGAAGG

Праймеры в области BAC-клона 87P17 у 5’ конца локуса Avi-piwi2:

#2316 N87P17Nvi-piwi2_TAIL1 GTGGCAAAAGACCTTTACAGTGTGTC #2246 N87P17Nvi-piwi2_TAIL2 TTGGATGTCCTTGGACAGGTAAG #2317 N87P17Nvi-piwi2_TAIL3 CAAACTAGTGCCGTGTTAAGCAATC Для получения последовательности ДНК, граничащей с интегрированным в геном P. dumerilii трансгеном на основе транспозона Mos1, из червей линий tuba::egfpvbci1 и r-opsin::egfpvbci2 выделяли гДНК и использовали по 1 образцу на линию в 4 сериях ПЦР, каждая из которых имела 8 вариантов (с 8 различными вырожденными праймерами). Результат первой реакции разводили 1:25 и добавляли по 1 мкл во вторую (полугнездовую) реакцию, аналогичным образом ставили третью (следующую полугнездовую) реакцию.

ПЦР смесь:

ДНК 5 µl 5х HF буфер (с 7,5 mM MgCl2) 4 µl dNTPs (10 mM) 1 µl геноспецифичный праймер (5 µМ) 0,8 µl вырожденный праймер (100 µМ) 1 µl Phusion ДНК-полимераза (NEB) 0,2 µl H2O 8 µl ИТОГО 20 µl ПЦР программа (первая реакция): 95°С – 5 мин, 98°C – 30 сек, 94°C – 1 мин, 95°C

– 1 мин, (94°C – 1 мин, 65°C – 1 мин, 72°C – 30 сек)х5 циклов, 94°C – 1 мин, 25°C – 3 мин, 72°C – 3 мин, (94°C – 30 сек, 64°C – 1 мин, 72°C – 3 мин, 94°C – 30 сек, 64°C – 1 мин, 72°C

– 3 мин, 94°C – 30 сек, 44°C – 1 мин, 72°C – 3 мин)х15 циклов, 72°C – 5 мин.

ПЦР программа (вторая реакция): 95°С – 5 мин, 98°C – 30 сек, (94°C – 30 сек, 64°C

– 1 мин, 72°C – 3 мин, 94°C – 30 сек, 64°C – 1 мин, 72°C – 3 мин, 94°C – 30 сек, 44°C – 1 мин, 72°C – 3 мин)х14 циклов, 72°C – 5 мин.

ПЦР программа (третья реакция): 95°С – 5 мин, 98°C – 30 сек, (94°C – 30 сек, 64°C

– 1 мин, 72°C – 3 мин, 94°C – 30 сек, 64°C – 1 мин, 72°C – 3 мин, 94°C – 30 сек, 44°C – 1 мин, 72°C – 3 мин)х12 циклов, 72°C – 5 мин.

Для воссоздания последовательности контигов в ВАС-клонах up-stream 5’ конца генов интереса сходным образом осуществляли TAIL-ПЦР на образцах очищенной ВАСДНК.

RT-ПЦР С помощью полуколичественной полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР, RT-PCR) изучали относительный уровень экспрессии генов Pdu-twist, Pdu-mapk, Pdu-mapkk в ходе эмбрионального и ларвального развития P.

dumerilii. По 2–3 эмбриональных культуры от разных родителей промывали через сито, концентрируя в 2 мл пробирке, осаждали центрифугированием, отбирали морскую воду и замораживали в жидком азоте, а затем хранили при -80°C. мРНК выделяли с помощью RNeasy Mini Kit – Purification of Total RNA from Animal Tissues (Qiagen) по протоколу производителя. Обратную транскрипцию проводили набором QuantiTect Reverse Transcription Handbook (Qiagen), предусматривающим элиминацию возможного контаминанта – гДНК. Полученные образцы кДНК разводили в воде 1:1 и использовали в ПЦР.

ПЦР смесь:

ДНК 1 µl 10х CL буфер (с 15 mM MgCl2) 2,5 µl dNTPs (10 mM) 0,8 µl праймер прямой(5 µМ) 1 µl праймер обратный (5 µМ) 1 µl Taq ДНК-полимераза (Qiagen) 0,2 µl H2O 18,3 µl ИТОГО 25 µl ПЦР программа: 95°С – 5 мин, (94°С – 20 сек, 57/61°С – 45 сек, 72°С – 20 сек)х40 циклов, 72°С – 5мин.

Праймеры подбирали к последовательностям Pdu-twist, Pdu-mapk, Pdu-mapkk из базы данных http://4dx.embl.de/platy так, чтобы они находились в разных экзонах.

Этим достигалось полное избавление результатов от возможной контаминации гДНК, поскольку протяженные области, включающие интроны, не могли быть амплифицированы в применявшихся условиях реакции. В качестве референсного гена использовали Pdu-rps9, кодирующий белок рибосом S9, для которого показано постоянство уровня экспрессии (Lidke et al., 2014). Для амплификации Pdu-twist и Pdumapk (ампликоны длиной 222 bp и 161 bp, соответственно) применяли температуру отжига +61°С, для Pdu-mapkk и Pdu-rps9 (ампликоны длиной 265 bp и 254 bp, соответственно) – +57°С.

Праймеры:

#2433 Pdu-twi_ex1_up2 CGAATGGAGGGTGCCTGGTC (Tm=65°С);

#2330 Pdu-twi_ex2_lo1 TGGTCCAAGATCAGAAGACACC (Tm=62°С);

Pdu-mapk_up1 GGTTCTCCAAGCACGGAAGACCT (Tm=67°С);

Pdu-mapk_lo1 GGGTTGAACGTAAGCATTCTGTCC (Tm=65°С);

#486 mapkk-ex5_for CAGCACAAAATGACGATAAAGGAG (Tm=62°С);

#487 mapkk-ex7_rev CAAAATGCTGCTCTCCGTCAGG (Tm=64°С);

#831 rps9_up ATGCCGCGCATACCATTGGTGTAC (Tm=67°С);

#903 rps9_lo ACTCCAATACGGACCAGACG (Tm=61°С).

Результаты ПЦР анализировали электрофорезом в агарозном геле. На сделанных фотоснимках с помощью ImageJ измеряли интенсивность окраски полос (оптическую плотность). Через отношение этого показателя у ампликонов гена интереса и у референсного гена рассчитывали относительный уровень мРНК в условных единицах (за 1 принимали это значение в яйце).

2.4. Анализ локализации белков и нуклеиновых кислот Иммуноцитохимия Зародышей A. virens промывали через сито для клеточных культур с ячеей 40 µ морской водой, отмывали от слизистой оболочки в TCMFSW (Tris + Ca/Mg-free sea water) 1–2 мин и незамедлительно фиксировали в течение ночи при +4°С в 4% формалине на 1,75х фосфатном буфере с 0,1% Tween 20. TCMFSW (pH 8,0) состоит из свежеприготовленных солей: Tris (конечная концентрация – 50 мМ), NaCl (495 мМ), KCl (9,7 мМ), Na2SO4 (27,6 мМ), NaHCO3 (2,3 мМ), ЭДТА (6,4 мМ) на дистиллированной воде (Костюченко, 1999; Kozin et al., 2016). После фиксации объекты переводили в 70% этанол и хранили при -20°С.

Для иммуноцитохимического выявления активной (дифосфорилированной) формы MAP-киназы (dpErk1/2) материал регидратировали в спиртах понижающейся концентрации (по 5 мин в 50% и 25% этаноле) и промывали 5 раз по 5 мин в PBT (1x фосфатный буфер PBS pH 7,4 + 0,1% Triton X-100 + 0,1% азид натрия). Для пермиабилизации желточной оболочки объекты переваривали протеиназой К (100 мкг/мл при +22°С в течение 30 сек), после чего отмывали в 2 быстрых сменах глицина на PBT (2 мг/мл) и 5 сменах PBT. Забивку проводили 2 ч в 5% овечьей сыворотке на PBT.

Инкубация в первичных антителах в 2,5% сыворотке на PBT продолжалась 1–2 дня при +4°С. После отмывок в PBT (6 раз в течение как минимум 2 ч) добавляли раствор флуоресцентных вторичных антител.

Использовали следующие разведения антител:

1:100 rabbit anti-Phospho-p44/42 MAPK (Cell Signaling #4370), 1:2000 mouse anti--tubulin (Sigma T5168), 1:200 mouse anti--tubulin (Sigma T4026), 1:400 AF488-conjugated antirabbit (Invitrogen A11034), 1:400 Cy5-conjugated anti-mouse (Jackson ImmunoResearch 715-175-150). Отмывки от вторичных антител сочетали с окрашиванием ядерной ДНК в DAPI (Sigma) в течение 1–2 ч. Объекты пропитывали в 90% глицерине с 10% PBT и хранили при -20°С.

Гибридизация in situ В качестве матрицы для синтеза меченых РНК-зондов использовали клонированные фрагменты генов Avi-twist (клон rk155, 3’RACE-фрагмент длиной ~1,2 kb), Avi-mox (клон frkt#1292, 5’RACE-фрагмент длиной ~1,0 kb), Avi-evx (клон frkt#1287, 3’RACE-фрагмент длиной ~1,7 kb), Avi-vasa (клон rk235, 5’RACE-фрагмент длиной ~1,6 kb), Avi-pl10 (клон rk263, 5’RACE-фрагмент длиной ~1,8 kb), Avi-piwi1 (клон rk229, 3’RACE-фрагмент длиной ~1,3 kb), Avi-piwi2 (клон rk232, 3’RACE-фрагмент длиной ~1,2 kb).

Плазмиды выделяли из бактериальных клеток (клонов) набором JETQUICK Plasmid Miniprep Spin Kit (Genomed) по протоколу производителя, растворяли в воде, определяли концентрацию на спектрофотометре. Линейную форму фрагмента гена (матрицу для транскрипции in vitro) получали путем рестрикции или ПЦР.

Электрофорезом в агарозном геле проверяли длину полученного линейного фрагмента, который затем очищали китом QIAquick PCR purification kit (Qiagen). С помощью транскрипции in vitro синтезировали меченные дигоксигенином (DIG) РНКзонды.

Реакцию объемом 20 мкл собирали на льду, последовательно добавляя следующие компоненты (Roche):

H2O (RNAse free) х µl ДНК-матрица (0,5–1 µg) 12 µl max 10x буфер 2 µl DTT (100 mM) 2 µl NTP/DIG-UTP-Mix 2 µl RNase inhibitor 1 µl РНК-полимераза 1 µl ИТОГО 20 µl В зависимости от ориентации вставки использовали T7 или Sp6 РНК-полимеразу (Roche). После 4–12 ч инкубации при +37°С в реакцию добавляли 1 мкл ДНКазы I (Roche), инкубировали еще 15 мин, а затем выделяли продукт китом RNeasy Mini Kit – RNA clean up (Qiagen). РНК-зонд элюировали в 50 мкл безРНКазной воды и проверяли качество продукта электрофорезом в агарозном геле (аликвоту РНК предварительно денатурировали в формамид-содержащем буфере 5–10 мин при +80°С).

Зародышей и личинок A. virens концентрировали в сите для клеточных культур с ячеей 40 µ и фиксировали в течение ночи при +4°С в 4% формалине на 1,75х фосфатном буфере с 0,1% Tween 20. Затем фиксации переводили в этиловый или метиловый спирт и хранили при -20°С. Молекулярная гибридизация in situ на тотальных препаратах (whole mount in situ hybridization, WMISH) была проведена в соответствии с опубликованным протоколом (Tessmar-Raible et al., 2005). Принцип WMISH состоит в выявлении специфической эндогенной РНК с помощью гибридизации с комплементарным антисмысловым РНК-зондом, помеченным антигеном DIG.

Фиксированные образцы переводили в водную фракцию, проводя по градиенту спиртов (75%, 50%, 25% метанол на PTW (1x фосфатный буфер PBS pH 7,4 с 0,1% Tween 20)) до PTW, обрабатывали протеиназой К (100 мкг/мл при +22°С в течение 0,5–1 мин), постфиксировали и инкубировали 1–12 ч в гибридизационном буфере (50% формамид, 5x SSC, 50 мкг/мл гепарин, 5 мг/мл Torula-RNA, 0,1% Tween 20). После гибридизации с РНК-зондом, проходящей при +65°С 1–2 дня, и отмывки в 2x SSC с 50% формамидом, 2x SSC и 0,2x SSC, производили забивку образцов и антител в 5–2,5% овечьей сыворотке (1–2 ч). Инкубацию с антителами против DIG, конъюгированными с ферментом щелочная фосфатаза (Digoxigenin-AP Fab fragments, Roche), проводили в течение ночи при +4°С. За отмывкой от антител в PTW в течение 1,5–2 ч и переводом в щелочной буфер (pH 9,0) следовал этап окрашивания (проявки) в растворе субстрата BCIP/NBT (Roche). При этом щелочная фосфатаза вырабатывает цветной нерастворимый продукт реакции, детектируемый на клеточном уровне. Окрашенные объекты отмывали от субстрата и пропитывали 90% глицерином для дальнейшего микроскопического анализа.

В некоторых случаях WMISH сочеталась с методом иммуноцитохимии.

Первичные антитела к ацетилированному -тубулину (Sigma) добавляли к антителам против DIG, а вторичные, меченые FITC (Sigma), – после цветной реакции (проявки) с субстратом BCIP/NBT. После гибридизации in situ проводили дополнительное окрашивание ядерной ДНК флуоресцентным маркером DAPI.

Методы микроскопии и работа с изображениями Результаты гибридизации in situ, иммуноцитохимии и экспериментов по трансгенезу обрабатывали при помощи световой, флуоресцентной и лазерной конфокальной микроскопии. При изучении образцов на светооптическом уровне применяли метод дифференциального интерференционного контраста (DIC, оптика Номарского). При этом делали серию снимков в разных фокальных плоскостях. Для отображения всех доменов экспрессии эти снимки иногда объединяли в программах ImageJ и Adobe Photoshop CS 5.1. Выявление сигнала BCIP/NBT на конфокальном микроскопе проводили по опубликованным рекомендациям (Jkely, Arendt, 2007).

Конфокальные изображения анализировали и создавали максимальные Z-проекции в программах ImageJ и LAS AF Lite (Leica Microsystems). Иллюстрации редактировали в Microsoft Publisher 2010 и Adobe Illustrator CS 5.1.

Для морфометрического анализа длины МП на изображениях распределения мРНК Avi-twist с помощью программы AxioVision 4.8 измеряли расстояние по вентральной медианной линии (Рис. 55). В программах STATISTICA 10 (StatSoft) и Microsoft Excel 2010 рассчитывали среднее, дисперсию и 95% доверительный интервал (n=18). Статистическую значимость отличий проверяли однофакторным дисперсионным анализом (ANOVA тест) и Post-hoc тестом.

Глава 3. Результаты

3.1. Анализ структурно-функциональной организации и экспрессии генов интереса В настоящей работе для полихеты A. virens были клонированы и проанализированы фрагменты генов Twist, Mox, Evx, Vasa, PL10 и Piwi, гомолог Twist был также идентифицирован и отклонирован для P. dumerilii (Рис. 17, Таблица 1). Из просеквенированных участков кДНК и гДНК были восстановлены полноразмерные последовательности, содержащие предполагаемые 5’ UTR, протяженные ORF и 3’ UTR для генов Twist, Evx, Vasa, и Piwi. В связи с техническими трудностями последовательности Mox и PL10 остались неполными на 3’ конце. У обеих полихет было обнаружено по два паралогичных гена Piwi (Piwi1 и Piwi2), для остальных генов удалось найти по одному гомологу. Впервые идентифицированные гены A. virens были названы Avi-twist, Avi-mox, Avi-evx, Avi-vasa, Avi-pl10, Avi-piwi1 и Avi-piwi2; Twist нереиды P. dumerilii был описан ранее под названием Pdu-twist (Pfeifer et al., 2013).

Рис. 17. Строение транскриптов проанализированных генов интереса. Зелеными блоками отмечена некодирующая часть (UTR), белок-кодирующая область (CDS) выделена оливковым, вертикальные линии внутри блоков маркируют границы экзонов. Красные блоки показывают участки, кодирующие в белке консервативные домены. Цифрами обозначена длина последовательности кДНК.

–  –  –

3.1.1. Twist Предоставленные фрагменты гомолога Twist у A. virens составляют последовательность длиной 1529 bp, соответствующий клонированный ген P. dumerilii (по данным геномной и транскриптомной базы http://4dx.embl.de/platy – это единственный ортолог) состоит из 1890 bp. Геномный локус Twist занимает около 6 kb в гДНК A. virens и около 9 kb – в случае P. dumerilii. Гомологи Twist этих полихет представлены двумя экзонами и одним протяженным интроном (Рис. 18). Первый экзон состоит из 5’ UTR (длиной 31 bp у A. virens и 48 bp – у P. dumerilii), ORF, соответствующей белок-кодирующим последовательностям (CDS) Twist других животных (615 bp у A. virens и 669 bp – у P. dumerilii) и семинуклеотидного фрагмента 3’ UTR. Второй экзон содержит остальную часть 3’ UTR длиной 876 bp у A. virens и 1166 bp

– у P. dumerilii. Последовательности кДНК были проверены с помощью базы данных UTRSite на предмет специфических мотивов UTR. У обоих генов на 3’ конце был локализован сигнал полиаденилирования (Polyadenylation Signal, PAS). У Pdu-twist кроме этого в 5’ UTR был обнаружен один сайт связывания с белком Musashi (Musashi binding element, MBE), а в 3’ UTR – еще три подобных сайта.

Рис. 18. Геномные локусы гена Twist у нереид. Экзоны обозначены коричневыми блоками, белок-кодирующая область выделена оливковым. Цифрами обозначена длина последовательности гДНК в bp.

Предполагаемый белок Avi-twist (получаемый при трансляции CDS) состоит из 204 aa, Pdu-twist – из 222 aa. При их выравнивании идентичными являются 169 аа (76%). Несколько ближе к С-терминальному концу полипептидов расположены консервативные домены bHLH и WR (Рис. 19).

Филогенетический анализ белковых последовательностей Twist подтвердил ортологичность клонированных генов Avi-twist и Pdu-twist (Рис. 20). На филогенетическом древе Avi-twist и Pdu-twist стоят ближе всего к гомологам Twist полихеты Capitella и моллюска Crassostrea, но не формируют с ними четких кластеров, содержащих определенные паралоги.

Кроме того, не наблюдается соответствия паралогов Twist1 и Twist2 Capitella и одноименных последовательностей рыбки Danio и мыши (Рис. 20), что говорит о независимых поздних дупликациях гена Twist у некоторых представителей Spiralia и позвоночных. Наибольшее сродство с гомологами позвоночных по первичной структуре имеет единственный ортолог Twist актинии Nematostella. Особняком стоят, по-видимому, наиболее быстро дивергировавшие (что отражает длина их ветвей) последовательности насекомых. Напротив, для Avi-twist и Pdu-twist характерна относительно небольшая длина ветви, превосходящая лишь длину ветви Twist2 полихеты Capitella и Twist шелкопряда Bombyx, что свидетельствует о малой степени дивергенции этих четырех последовательностей.

Рис. 19. Строение предполагаемых белковых продуктов Twist у нереид. Фиолетовым выделены консервативные домены bHLH и WR. Цифрами обозначена длина последовательности в аминокислотных остатках.

Рис. 20. Филогенетическое древо аминокислотных последовательностей Twist по методу максимального правдоподобия (Maximum likelihood). Для каждой последовательности приведен буквенно-цифровой код из базы NCBI. Оценка статистической достоверности узла на основе aLRT обозначена цифрами. Шкала в количестве замен на позицию.

С помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР, RT-PCR) была охарактеризована временная экспрессия гомолога Twist у P. dumerilii.

мРНК Pdu-twist присутствует на всех изученных стадиях развития, начиная с неоплодотворенного яйца и заканчивая средней нектохетой (96 чпо) (Рис. 21). Как видно по интенсивности окраски полос на геле (относительной оптической плотности), в период дробления (начало формирования второго квартета микромеров (3,5 чпо), формирование четвертого квартета микромеров (5 чпо), формирование М-клеток (5,5 чпо)) уровень экспрессии Pdu-twist примерно соответствует таковому в яйце. Заметное увеличение относительного количества транскриптов Pdu-twist наблюдается со стадии поздней гаструлы/протрохофоры (16 чпо). Наибольшей интенсивности экспрессия Pdutwist достигает на личиночных стадиях – у ранней трохофоры (24 чпо) и ранней метатрохофоры (48 чпо) (Рис. 21). У нектохет (72 чпо и 96 чпо) уровень экспрессии несколько меньше, чем у более ранних личинок. Описанный паттерн временной экспрессии свидетельствует о том, что Pdu-twist является геном материнского эффекта, т.е. его мРНК запасается еще в период оогенеза. Также можно с уверенностью говорить об активации зиготической экспрессии Pdu-twist во время гаструляции.

Рис. 21. Результаты RT-ПЦР, отражающие временную динамику уровня экспрессии Pdutwist. Цифрами на шкале абсцисс обозначены стадии развития: 1 – выметанные неоплодотворенные яйца (0 чпо); 2 – начало формирования второго квартета микромеров (3,5 чпо), 3 – формирование соматобласта 4d и четвертого квартета микромеров (5 чпо), 4 – переход к билатеральному дроблению и формирование Мклеток (5,5 чпо), 5 – поздняя гаструла/протрохофора (16 чпо), 6 – ранняя трохофора (24 чпо), 7 – ранняя метатрохофора (48 чпо), 8, 9 – нектохета (72 чпо и 96 чпо). А – ампликоны Pdu-twist и референсного гена Pdu-rps9 на агарозном геле. Б – график с рассчитанным относительным уровнем мРНК Pdu-twist.

Для изучения пространственного паттерна экспрессии Twist были проведены эксперименты по выявлению мРНК гена Avi-twist у зародышей и личинок A. virens с помощью молекулярной гибридизации in situ на тотальных препаратах (WMISH).

Оказалось, что Avi-twist на всех рассмотренных стадиях онтогенеза дифференциально экспрессируется в мезодерме и ее производных (Рис. 22–24).

Рис. 22. Распределение мРНК Avi-twist на ранних этапах эмбриогенеза. А–Г – гибридизация in situ, DIC; Д, Е – гибридизация in situ (красный канал), совмещенная с окраской ядер (синий) с помощью DAPI и выявлением тубулина (зеленый) флуоресцентными антителами, конфокальная микроскопия; Д – максимальная проекция конфокального Z-стека; Е – отдельный конфокальный снимок. А – позднее дробление, виден соматобласт 4d. Б – переход к билатеральному дроблению, Мклетки – единственная область экспрессии Avi-twist. В–Е – ранняя гаструла, появление экспрессии Avi-twist в эктомезодерме. Время развития в чпо указано в верхнем правом углу. Вид с вегетативного полюса. Энтомезодерма (клетки 4d и M) отмечены оранжевым пунктиром, эктомезодерма (клетки третьего квартета микромеров 3a–3d) – белым пунктиром, вторичный мезобласт (6 мелких потомков М-клеток в дорсальной губе бластопора, предположительно – популяция ППК) показан белыми стрелками, dors, vent – дорсальная и вентральная сторона, соответственно, 4А, 4B, 4C, 4D – макромеры на дне бластопора. Масштаб 25 мкм.

Наиболее ранний дифференциальный сигнал мРНК Avi-twist был обнаружен в период завершения дробления (после формирования четвертого квартета микромеров, 13 чпо). В этот момент экспрессия приурочена к дорсальной стороне зародыша, т.е. к бластомерам D-квадранта. На субклеточном уровне мРНК Avi-twist преимущественно распределена по свободной от желтка цитоплазме. При рассмотрении зародыша с вегетативного полюса сигнал Avi-twist наблюдается в пределах соматобласта 4d (Рис. 22 А). После деления 4d (к 16 чпо) единственными Avitwist-положительными бластомерами становятся его потомки – М-клетки (Рис. 22 Б).

После начала гаструляции (18 чпо) по бокам от мезотелобластов М начинает выявляться по одной относительно крупной клетке, которые вместе с М-клетками экспрессируют Avi-twist на высоком уровне (Рис. 22 В). Указанные боковые клетки в соответствии с их расположением, формой и размером можно отнести к микромерам 3с и 3d. Еще через несколько часов (к 20 чпо) мы наблюдали сигнал мРНК Avi-twist в мезотелобластах и четырех дополнительных клетках, лежащих на противоположных сторонах бластопора (Рис. 22 Г). Поскольку указанные клетки находятся на поверхности зародыша и расположены вокруг центра гаструляции – бластопора – данный паттерн экспрессии Avi-twist можно назвать циркумбластопоральным. С дорсальной стороны бластопор окаймляют потомки 4d (M-клетки), 3с и 3d, а клетки в вентролатеральных положениях являются ни чем иным как микромерами 3а и 3b. Таким образом, на ранних этапах гаструляции Avi-twist экспрессируется исключительно в мезодермальных бластомерах: в энтомезодермальных М-клетках и полном наборе эктомезодермальных клеток (микромерах третьего квартета 3а–3d).

У нереидных полихет в ходе гаструляции путем эпиболии эктодермальные клетки обрастают мезодермальные бластомеры, при этом бластопор постепенно закрывается и смещается с вегетативного полюса кпереди, на вентральную сторону.

Вместо бластопора здесь образуется стомодеальная пластинка – клеточный материал будущей передней кишки. В результате пролиферации из М-клеток формируются билатеральные мезодермальные полоски (МП), находящиеся между эктодермой и массой макромеров. На изученной нами стадии протрохофоры (32 чпо) каждая из полосок состоит из порядка 10-ти клеток различного размера. Avi-twist экспрессируется примерно в половине этих клеток, расположенных в основном на дорсальной стороне МП (Рис. 23). Наиболее интенсивный сигнал мРНК Avi-twist наблюдается в передней части каждой МП, тогда как в мезотелобластах (терминальных задних клетках МП) этот сигнал существенно слабее. Помимо МП, Avi-twist продолжает экспрессироваться в эктомезодермальных элементах, сосредоточенных по бокам и спереди от стомодеальной пластинки (Рис. 23). Как правило, на этой стадии выявляется 3–4 отдельных группы эктомезодермальных клеток: передние медиально расположенные группы с сильным сигналом мРНК Avi-twist и латеральные группы, сзади примыкающие к МП, – с гораздо более слабым сигналом.

Рис. 23. Экспрессия Avi-twist в конце эмбриогенеза у поздней гаструлы/протрохофоры (32 чпо). А–В – гибридизация in situ, DIC ; Г–Е – гибридизация in situ (красный канал), совмещенная с окраской ядер (синий) с помощью DAPI и выявлением тубулина (зеленый) флуоресцентными антителами, максимальная проекция конфокального Zстека. А, Б – вегетативная проекция, разные фокальные плоскости одного и того же зародыша; В, Е – дорсальная проекция, глубокий фокус; Г, Д – латеральная проекция, дорсальная сторона справа, разные фокальные плоскости одного и того же зародыша.

Энтомезодерма (мезодермальные полоски) отмечена оранжевым пунктиром, экспрессия в них показана белыми стрелками, экспрессия в эктомезодерме – оранжевыми треугольниками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума, зеленый пунктир – положение прототроха. Масштаб 25 мкм.

На стадии ранней трохофоры, когда личинки начинают плавать (43 чпо), эктомезодермальные Avi-twist-положительные клетки спереди от стомодеальной пластинки сближаются, так что формируется единый вытянутый в поперечном направлении домен экспрессии (Рис. 24 А). В латеральных группах эктомезодермальных клеток сигнал Avi-twist становится гораздо лучше различимым.

Эти латеральные домены экспрессии по переднезадней оси находятся почти на одном уровне с передними эктомезодермальными клетками. В пределах МП экспрессия Avitwist приобретает метамерный характер (Рис. 24 А). На каждую МП приходится по 3 домена экспрессии, захватывающие наиболее дорсальные энтомезодермальные клетки. Расположение этих доменов вдоль переднезадней оси МП указывает на то, что они, возможно, маркируют передние границы формирующихся мезодермальных компартментов. Наиболее яркие и обширные энтомезодермальные зоны экспрессии находятся на передней границе каждой МП. Терминальных мезотелобластов (отличимых более крупными размерами) на задних концах МП выявить на этой стадии не удается (вне зависимости от наличия или отсутствия экспрессии Avi-twist).

Рис. 24. Экспрессия Avi-twist (А–Д) и Avi-mox (Е–К) в начале ларвального развития.

Гибридизация in situ, DIC. А, Е – ранняя трохофора (43 чпо); Б, В – средняя трохофора (59 чпо); Г, Д, И, К – ранняя метатрохофора (90 чпо); Ж, З – средняя трохофора (54 чпо).

А, Б, Г, Е, Ж, И – вентральная проекция; В, Д, З, К – латеральная проекция, дорсальная сторона справа. Энтомезодерма (мезодермальные полоски) отмечена оранжевым пунктиром, метамерность экспрессии в гипосфере показана черными стрелками, экспрессия в эктомезодерме – оранжевыми треугольниками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума, + – хетоносный мешок.

Масштаб 25 мкм.

На стадии средней трохофоры (59 чпо) Avi-twist экспрессируется примерно на одинаковом высоком уровне как в энто-, так и в эктомезодермальных тканях (Рис. 24 Б, В). Последние расположены непосредственно над и по бокам (несколько ближе к задней границе) от сформированного стомодеума. Сзади латеральные эктомезодермальные домены экспрессии все так же примыкают к передним концам МП. В самих МП экспрессия Avi-twist наблюдается в заметно большем количестве более мелких клеток, чем на предшествующей стадии (Рис. 24 Б, В). Паттерн экспрессии в энтомезодерме является отчетливо метамерным, вдоль переднезадней оси МП отличимы более обширные, чем ранее, домены, причем самый задний клеточный домен в каждой МП крупнее передних двух.

В целом следует отметить, что, начиная со стадии протрохофоры, количество Avi-twist-положительных клеток неуклонно растет, они погружены внутрь зародыша и, как и на стадии гаструлы с циркумбластопоральным паттерном экспрессии, расположены по кругу, окаймляя вентральную часть гипосферы. Вместе с конвергентным вытяжением, происходящем в эктодермальных тканях, изменяется структура и расположение мезодермальных зачатков: группы эктомезодермальных клеток сближаются друг с другом, МП вытягиваются вдоль переднезадней оси и метамеризуются.

Начиная со стадии ранней метатрохофоры у нереидных полихет следует говорить о дифференциации МП, которая проявляется в постепенном созревании мускулатуры гипосферы (Wilson, 1892; Fischer et al., 2010). Метамерный характер экспрессии Avi-twist сохраняется на этой стадии. мРНК Avi-twist локализуется в группах клеток вокруг пучков щетинок, лежащих в хетоносных мешках будущих параподий (Рис. 24 Г, Д). Каждый из шести пар хетоносных мешков примерно посередине его проксимодистальной оси опоясан кольцом клеток, экспрессирующих Avi-twist на высоком уровне. Такое расположение полностью соответствует месту формирования параподиальных мышц (Fischer et al., 2010). Эктомезодермальный домен экспрессии Avi-twist приобретает вид сначала незамкнутого на задней границе (Рис. 24 Г), а позднее замкнутого кольца вокруг стомодеума. Кроме того, экспрессия Avi-twist выявляется в более глубоких медиальных клетках, примыкающих к многослойному эпителию эписферы, из которого формируется головной мозг.

3.1.2. Mox Для гомолога Mox A. virens нам удалось отклонировать лишь 5’ фрагмент кДНК протяженностью 1019 bp (Рис. 25), который содержит 5’ UTR (длиной 347 bp) и часть ORF (длиной 672 bp), соответствующую N-концевой части CDS Mox других животных.

Поиск в геномной и транскриптомной базе данных P. dumerilii выявил лишь один гомолог Mox у этого червя. Фрагмент предполагаемой белковой последовательности Avi-mox состоит из 224 аа, последние 50 аа которого входят в состав консервативного гомеодомена (Рис. 26).

Филогенетический анализ аминокислотной последовательности подтвердил принадлежность Avi-mox соответствующему семейству ТФ (Рис. 27). Avi-mox имеет одну из наиболее коротких ветвей. На дендрограмме он формирует четкий кластер с гомологами Mox других Spiralia – аннелид и моллюсков. Наибольшее сродство этот кластер имеет к гену MoxA актинии Nematostella (Рис. 27). Последовательности позвоночных формируют на филогенетическом древе общую ветвь, причем друг с другом группируются одноименные паралоги Mox1 рыбки Danio и мыши (Dre_mox1_NP_001002450 с Mmu_mox1_NP_034921). В основании древа находятся последовательности Mox насекомых, характеризующиеся достаточно выраженным разбросом длины ветвей.

Рис. 25. Строение 5’ концевого фрагмента транскрипта гена Mox у A. virens. Зеленым отмечена некодирующая часть, белок-кодирующая область выделена оливковым.

Цифрами обозначена длина последовательности кДНК в bp.

Рис. 26. Строение N-концевого фрагмента предполагаемого белкового продукта Mox у A. virens. Фиолетовым выделен консервативный гомеодомен. Цифрами обозначена длина последовательности в аминокислотных остатках.

Рис. 27. Филогенетическое древо аминокислотных последовательностей Mox по методу максимального правдоподобия (Maximum likelihood). Для каждой последовательности приведен буквенно-цифровой код из базы NCBI. Оценка статистической достоверности узла на основе aLRT обозначена цифрами. Шкала в количестве замен на позицию.

Пространственно-временной профиль экспрессии Avi-mox был изучен с помощью гибридизации in situ. Наиболее раннюю экспрессию удалось выявить на стадии ранней трохофоры. В это время мРНК Avi-mox локализуется в небольшом количестве энтомезодермальных клеток на переднем конце МП (Рис. 24 Е). Данное расположение примерно соответствует самому переднему из метамерных доменов экспрессии Avi-twist на соответствующей стадии (Рис. 24 А). Позднее, на стадии средней трохофоры, экспрессия Avi-mox распространяется по всей длине МП и имеет отчетливо метамерный характер (Рис. 24 Ж, З). Как и в случае с Avi-twist на каждую МП приходится по 3 домена экспрессии (Рис. 24 Б, Ж). Отличие же от паттерна Avi-twist состоит в уменьшении размеров этих метамерных доменов Avi-mox спереди назад, т.е.

наиболее крупным является передний домен, а не задний, как в случае Avi-twist. В это же время над стомодеумом появляется небольшая группа эктомезодермальных Avimox-положительных клеток (Рис. 24 Ж).

На стадии ранней метатрохофоры вдобавок к несколько увеличившемуся переднему медиальному эктомезодермальному домену по бокам от стомодеума возникают новые билатерально-симметричные эктомезодермальные домены экспрессии Avi-mox (Рис. 24 И). Эти латеральные домены существенно меньше доменов экспрессии Avi-twist в соответствующей области и, по-видимому, полностью перекрываются с последними.

В энтомезодерме метамерность паттерна экспрессии Avi-mox сохраняется, хотя и становится менее отчетливой. В сравнении с трохофорной личинкой, область энтомезодермальных Avi-mox-положительных клеток у метатрохофор сильно увеличивается, особенно в поперечном направлении. В передних участках МП домены экспрессии Avi-mox значительно шире по сравнению с таковыми на заднем конце МП. Сравнивая энтомезодермальные паттерны экспрессии Avi-mox и Avi-twist можно отметить, что они более не пересекаются: сигнал мРНК Avimox выявляется в клетках, расположенных гораздо более вентрально (в зачатках косых мышц и/или целомических мешков), причем эти клетки граничат лишь с базальными частями вентральных хетоносных мешков (Рис. 24 К).

3.1.3. Evx У A. virens протяженность клонированного из кДНК гомолога Evx составляет 2305 bp (Рис. 28). Эта последовательность включает 5’ UTR (длиной 230 bp), ORF (длиной 1251 bp), соответствующую CDS Evx других животных и 3’ UTR (длиной 824 bp). Поиск в геномной и транскриптомной базе данных P. dumerilii выявил лишь один гомолог Evx у этого червя. Предполагаемый белок Avi-evx состоит из 416 aa, в центральной его части закодирован консервативный гомеодомен (Рис. 29).

Рис. 28. Строение транскрипта гена Evx у A. virens. Зеленым отмечена некодирующая часть, белок-кодирующая область выделена оливковым. Цифрами обозначена длина последовательности кДНК в bp.

Рис. 29. Строение предполагаемого белкового продукта Mox у A. virens. Фиолетовым выделен консервативный гомеодомен. Цифрами обозначена длина последовательности в аминокислотных остатках.

Рис. 30. Филогенетическое древо аминокислотных последовательностей Evx по методу максимального правдоподобия (Maximum likelihood). Для каждой последовательности приведен буквенно-цифровой код из базы NCBI. Оценка статистической достоверности узла на основе aLRT обозначена цифрами. Шкала в количестве замен на позицию.

С помощью филогенетического анализа аминокислотной последовательности Avi-evx была подтверждена ее принадлежность к семейству Evx (Рис. 30).

Кластеризация гомологов Evx отмечена для последовательностей насекомых и позвоночных. Как и в случае с генами Mox, одноименные паралоги Evx1 рыбки Danio и мыши (Dre_evx1_NP_ 571324 с Mmu_evx1_NP_031992) группируются вместе, что говорит о дупликации обоих Hox-связанных гомеобокс-содержащих генов Mox и Evx у общего предка позвоночных. Напротив, недавняя дупликация Evx произошла у полихеты Capitella (Seaver et al., 2012), что отображено на древе в виде общей ветви, ведущей к практически не дивергировавшим друг от друга последовательностям Cte_evx1_AFJ66236 и Cte_evx2_AFJ66237 (Рис. 30). Остальные гомологи Evx спиралий разбросаны на дендрограмме по ветвям разного порядка. Avi-evx характеризуется наименьшей длиной ветви, немногим большую длину имеют последовательности P.

dumerilii и моллюска Crassostrea.

По данным гибридизации in situ Avi-evx экспрессируется у эмбрионов и личинок A. virens в клетках, принадлежащих как эктодермальному, так и мезодермальному зародышевому листку. Самая ранняя дифференциальная экспрессия Avi-evx отмечена со стадии протрохофоры. Обширный эктодермальный домен экспрессии охватывает поверхностные клетки (потомки соматобласта 2d) на дорсальной и вегетативной стороне зародыша (Рис. 31 А–Г). Одновременно с этим сигнал мРНК Avi-evx выявляется во всех клетках МП (Рис. 31 Б, В). Уже к стадии ранней трохофоры эта энтомезодермальная экспрессия практически полностью исчезает: всего 2–4 наиболее глубинные мелкие клетки у переднего края МП остаются Avi-evx-положительными (Рис.

31 Е, Ж). Вид эктодермального домена экспрессии также кардинально меняется. Он приобретает форму подковы, обрамляющей вегетативный полюс и открытой с вентральной стороны (Рис. 31 Д–З). Можно отметить, что этот домен экспрессии Avi-evx фактически маркирует заднюю и боковые границы интернализуемой эктодермы, т.е.

материала передней и задней кишки – стомодеума и проктодеума, которые занимает место бывшего бластопора.

На стадии средней трохофоры поверхностная эктодермальная область экспрессии продолжает видоизменяться, приобретая форму ракетки (Рис. 31 И–М). На вегетативном полюсе расположен овальный пятнистый домен, вытянутый в дорсовентральном направлении. От этого домена на вентральную сторону распространяется медиальная полоска Avi-evx-положительных клеток, оканчивающаяся немного не доходя до задней границы стомодеума (Рис. 31 И, Л, М).

В пределах описанной полоски экспрессия Avi-evx наблюдается во всей толще многослойной нейроэктодермы. На уровне переднего края этой полоски по бокам выявляется по 2 пары отдельных клеток или небольших клеточных групп базального слоя нейроэктодермы, экспрессирующих Avi-evx (Рис. 31 И). В МП у средних трохофор очень слабый сигнал мРНК Avi-evx едва уловим в нескольких передних энтомезодермальных клетках (Рис. 31 К).

Рис. 31. Экспрессия Avi-evx в ходе развития. Гибридизация in situ, DIC. А–Г – протрохофора (32 чпо); Д–З – ранняя трохофора (43 чпо); И–М – средняя трохофора (59 чпо); Н–Р – ранняя метатрохофора (90 чпо). А, Д, И, Н – вентральная проекция; Б, Е, К, О

– вентральная проекция, глубокая фокальная плоскость; В, Ж, Л, П – латеральная проекция, дорсальная сторона справа; Г, З, М, Р – вегетативная проекция.

Энтомезодерма (мезодермальные полоски) отмечена оранжевым пунктиром, домен экспрессии на переднем крае МП показан черными стрелками, экспрессия в эктодерме

– синими треугольниками, экспрессия в нейроэктодермальных клетках – синими стрелками, экспрессия в клетках вблизи хетоносных мешков – зелеными стрелками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума, + – хетоносный мешок. Масштаб 25 мкм.

На стадии ранней метатрохофоры экспрессия Avi-evx подвергается еще большему сокращению (Рис. 31 Н–Р). Ни в каких мезодермальных производных сигнала не наблюдается. На вентральной стороне гипосферы экспрессия Avi-evx отмечена в нескольких отдельных клетках, лежащих в средних по глубине слоях нейроэктодермы (Рис. 31 Н, П). Кроме того, Avi-evx экспрессируется в некоторых поверхностных и субэпителиальных клетках, метамерно расположенных по бокам тела и находящихся в тесной связи с хетоносными мешками (Рис. 31 О–Р).

3.1.4. Vasa и PL10 Изученные гомологи генов, кодирующие DEAD-box хеликазы Vasa и PL10, составлены у A. virens в кДНК из 2676 bp и 2366 bp, соответственно. Геномный локус Avi-vasa занимает около 17 kb и состоит из 20-ти экзонов длиной от 15 bp (экзон 12) до 310 bp (экзон 16) (Рис. 32 А). Из 19-ти интронов наименьшую длину имеет интрон 4 (80 bp), наибольшую – интрон 2 (5249 bp). 5’ UTR (длиной 132 bp) закодирована в 1-м и 2-м экзонах; экзоны со 2-го по 20-й содержат ORF (длиной 2427 bp), соответствующую CDS Vasa других животных; 3’ UTR (длиной 117 bp) занимает часть последнего (20-го) экзона.

Рис. 32. Геномные локусы генов Vasa, PL10 и Piwi у A. virens. Экзоны обозначены коричневыми блоками, белок-кодирующая область выделена оливковым. Цифрами обозначена длина последовательности гДНК в bp.

Локус Avi-pl10 в гДНК простирается более чем на 10 kb, в нем закодировано 15 экзонов длиной от 61 bp (экзон 2) до 322 bp (экзон 7) и 14 интронов длиной от 111 bp (интрон 8) до 1974 bp (интрон 3) (Рис. 32 Б). Первый экзон кодирует 5’ UTR (длиной 56 bp) и начало ORF, содержащейся также во всех последующих экзонах. Найденная ORF (общей длиной 2310 bp) соответствует CDS PL10 других животных и оканчивается стопкодоном. Часть гена Avi-pl10, содержащую 3’ UTR клонировать нам не удалось. Сходное количество экзонов описано для гомологичных генов позвоночных и Anthozoa, тогда как у представителей Ecdysozoa этот показатель ниже в два раза и более.

Рис. 33. Строение предполагаемых белковых продуктов Vasa и PL10 у A. virens.

Фиолетовыми блоками выделены консервативные домены ZF, DEAD и Hel C. Цифрами обозначена длина последовательности в аминокислотных остатках.

Рис. 34. Филогенетическое древо аминокислотных последовательностей Vasa и PL10 по методу максимального правдоподобия (Maximum likelihood). Для каждой последовательности приведен буквенно-цифровой код из базы NCBI. Оценка статистической достоверности узла на основе aLRT обозначена цифрами. Шкала в количестве замен на позицию.

Предполагаемые белковые последовательности Avi-vasa и Avi-pl10 состоят из 808 аа и 769 аа, соответственно.

У обоих белков выявлены консервативные участки:

хеликазный DEAD/DEAH-box и С-концевой хеликазный домен (Рис. 33). Кроме того, ближе к N-концу Avi-vasa содержит 6 цинк-фингерных мотивов CCHC-типа.

Филогенетический анализ подтвердил, что хеликазы Avi-vasa и Avi-pl10 являются представителями подсемейств DDX4/Vasa и DDX3/PL10, соответственно (Рис. 34). В основании каждого из этих кластеров находятся последовательности актинии Nematostella, также в обоих кластерах можно выделить группы последовательностей, принадлежащих одним и тем же представителям (1) позвоночных, (2) насекомых и (3) спиралий.

В последней из групп и в случае гомологов Vasa, и в случае PL10 происходит четкое разделение генов моллюсков и генов полихет. В целом, для гомологов PL10 характерна меньшая длина ветвей, чем у Vasa, что говорит о наибольшем числе замен на позицию и, следовательно, наибольшей степени дивергенции подсемейства DDX4/Vasa по сравнению с подсемействами DDX3/PL10 и DDX5/p68. В пределах кластеров DDX3/PL10 и DDX4/Vasa наименьшей длиной ветвей обладают последовательности спиралий, наибольшей – насекомых.

Результаты гибридизации in situ показали, что во время раннего развития гены Avi-vasa и Avi-pl10 экспрессируются почти повсеместно. Первые признаки дифференциальной экспрессии были выявлены со стадии ранней трохофоры (Рис. 35, 36).

Рис. 35. Экспрессия Avi-vasa в начале ларвального развития. Гибридизация in situ, DIC.

А–В – ранняя трохофора (43 чпо); Г–Е – средняя трохофора (59 чпо); Ж–И – ранняя метатрохофора (90 чпо). А, Г, Ж – вентральная проекция; Б, Д, З – вентральная проекция, глубокая фокальная плоскость; В, Е, И – латеральная проекция, дорсальная сторона справа. Энтомезодерма (мезодермальные полоски) отмечена оранжевым пунктиром, экспрессия в них показана белыми стрелками, экспрессия в основании МП (во вторичном мезобласте) – прозрачным треугольником, экспрессия в эктомезодерме

– оранжевыми треугольниками, экспрессия в эктодерме – синими треугольниками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума.

Масштаб 25 мкм.

Рис. 36. Экспрессия Avi-pl10 в начале ларвального развития. Гибридизация in situ, DIC.

А–В – ранняя трохофора (43 чпо); Г–Е – средняя трохофора (59 чпо); Ж–И – ранняя метатрохофора (90 чпо). А, Г, Ж – вентральная проекция; Б, Д, З – вентральная проекция, глубокая фокальная плоскость; В, Е, И – латеральная проекция, дорсальная сторона справа. Энтомезодерма (мезодермальные полоски) отмечена оранжевым пунктиром, экспрессия в них показана белыми стрелками, экспрессия в эктомезодерме

– оранжевыми треугольниками, экспрессия в эктодерме – синими треугольниками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума.

Масштаб 25 мкм.

У трохофорных личинок транскрипты Avi-vasa и Avi-pl10 детектируются в покровном эпителии гипосферы (Рис. 35 А, Б, Г, 36 А–Г), в случае Avi-vasa – преимущественно на вентральной стороне, в формирующейся вегетативной пластинке, а в случае Avi-pl10 – как на вентральной, так и на дорсальной стороне, выполненной более уплощенными эпидермальными клетками. Стоит отметить, что чаще всего сигнал мРНК обоих генов отсутствует в области презумптивного проктодеума, расположенного на вегетативном полюсе. Во всем эпителии эписферы трохофор и метатрохофор широко экспрессируется Avi-pl10 (Рис. 36 Б, В, Е, Ж), тогда как транскрипты Avi-vasa обнаруживаются лишь в отдельных доменах (Рис. 35 Б, В, Д, Е, Ж).

В области стомодеума в равной степени присутствует экспрессия Avi-vasa и Avipl10. Для стадии ранней трохофоры характерны картины локализации мРНК в расположенной ближе к вегетативному полюсу стомодеальной пластинке (с момента ее формирования) (Рис. 35 А, В, 36 А, В). У средних трохофор и ранних метатрохофор экспрессия Avi-vasa и Avi-pl10 также сопровождает развивающийся зачаток передней кишки, переместившийся ближе к экватору и претерпевший инвагинацию (Рис. 35 Г, Ж, 36 Г, Ж). Непосредственно к стомодеуму примыкают Avi-vasa-положительные и Avipl10-положительные клетки эктомезодермы. На стадии ранней трохофоры экспрессия Avi-vasa и Avi-pl10 обнаружена в крупных немногочисленных эктомезодермальных клетках по бокам стомодеальной пластинки и непосредственно над ней – в группе мелких клеток той же природы (Рис. 35 А, 36 А). У средней и поздней трохофоры количество эктомезодермальных клеток увеличивается, происходит их реаранжировка, и к стадии ранней метатрохофоры трехчастный домен вокруг стомодеума объединяется в полукольцо (Рис. 35 Ж, 36 Ж), а затем – в замкнутое кольцо.

Вторая часть мезодермального зачатка – энтомезодерма – экспрессирует гомологи Vasa и PL10 заметно сильнее, чем другие компартменты тела личинки. мРНК Avi-pl10 распределена по длине каждой МП равномерно (Рис. 36 Б–Е), тогда как Avivasa сильнее экспрессируется в ее задней части (Рис. 35 Б–Е). На стадии ранней метатрохофоры Avi-pl10 продолжает весьма обильно экспрессироваться латерально в большинстве глубинных клеток гипосферы, среди которых весьма вероятно присутствуют энтомезодермальные элементы (Рис. 36 Ж–И). Паттерн экспрессии Avivasa становится на этой стадии гораздо более дифференциальным: сигнал мРНК выявляется в билатерально-симметричных метамерных группах внутренних клеток, примыкающих к хетоносным мешкам (Рис. 35 З–И). Автор связывает эти домены экспрессии Avi-vasa с зачатками параподиальных мышц, в которых более масштабно экспрессируется Avi-twist.

На вегетативном полюсе, в месте соединения МП, расположенном кпереди от области проктодеума, был выявлен отдельный внутренний домен сильной экспрессии Avi-vasa и Avi-piwi1, состоящий на протяжении всего развития трохофоры из порядка 6– 8 мелких клеток (Рис. 35 Б, Д, 39 Б, Е). Наиболее вероятно, что этот клеточный компартмент (по месту локализации в теле трохофоры, размерам и количеству клеток) соответствует описанному Вильсоном (Wilson, 1892; Wilson, 1898) для нереиды Nereis limbata т.н. вторичному мезобласту (группа наиболее ранних мелких потомков Мклеток). У ранних метатрохофор соответствующий домен экспрессии Avi-vasa и Avipiwi1 заметно расширяется и все так же обладает наибольшей интенсивностью сигнала (Рис. 35 З, И, 39 К, Л).

3.1.5. Piwi Два изученных гомолога Piwi A. virens, названные Avi-piwi1 и Avi-piwi2, представлены в кДНК последовательностями длиной 3538 bp и 3566 bp, соответственно. Геномный локус Avi-piwi1 (Рис. 32 В) занимает около 18 kb, представляя собой 16 экзонов длиной от 177 bp (экзон 1) до 943 bp (последний 16-й экзон). Локус Avi-piwi2 (Рис. 32 Г) заметно короче – около 14 kb, состоит из 19 экзонов длиной от 56–58 bp (17-й и 1-й экзон, соответственно) до 731 bp (последний 19-й экзон). Наиболее протяженным у обоих генов является 1-й интрон (7075 bp у Avi-piwi1 и 7123 bp у Avi-piwi2), наименьшим интроном у Avi-piwi1 является 6-й (82 bp), у Avi-piwi2

– 18-й (87 bp). У обоих генов 5’ UTR (длиной 102 bp у Avi-piwi1 и 69 bp у Avi-piwi2) содержится в 1-м и 2-м экзоне. 2-й и последующие экзоны кодируют ORF (длиной 2610 bp у Avi-piwi1 и 2856 bp у Avi-piwi2), соответствующую CDS Piwi других животных.

Протяженная 3’ UTR (длиной 826 bp у Avi-piwi1 и 641 bp у Avi-piwi2) занимает большую часть последнего экзона.

Предполагаемые белки Avi-piwi1 и Avi-piwi2 состоят из 869 аа и 951 аа, соответственно. В центральной части этих последовательностей закодирован консервативный PAZ-домен, ближе к С-концу – Piwi-домен (Рис. 37). Филогенетический анализ выявил разделение белковых последовательностей Piwi большинства многоклеточных животных на два подсемейства – Piwi-1-подобное и Piwi-2-подобное, особняком стоят лишь гены Aubergine и Piwi дрозофилы. (Рис. 38). В обоих подсемействах встречаются гомологи Piwi одних и тех же организмов, за исключением единственного гена Piwi актинии Nematostella, вошедшего в нашем анализе в подсемейство Piwi-1. Это обстоятельство, скорее всего, указывает на древнее происхождение Piwi-1-подобного и Piwi-2-подобного паралога еще у общего предка Bilateria. Соответствующие паралоги были унаследованы в геноме A. virens и других спиралий (Capitella, Crassostrea), чьи последовательности группируются как в кластере Piwi-1, так и в кластере Piwi-2. Единственный известный для P. dumerilii ген Piwi (Rebscher et al., 2007) формирует общую ветвь с Avi-piwi1. Относительно небольшая длина ветвей, ведущих к последовательностям Avi-piwi1 и Avi-piwi2, говорит об умеренной скорости их дивергенции.

Рис. 37. Строение предполагаемых белковых продуктов Piwi у A. virens. Фиолетовыми блоками выделены консервативные домены PAZ и Piwi. Цифрами обозначена длина последовательности в аминокислотных остатках.

Рис. 38. Филогенетическое древо аминокислотных последовательностей Piwi по методу максимального правдоподобия (Maximum likelihood). Для каждой последовательности приведен буквенно-цифровой код из базы NCBI. Оценка статистической достоверности узла на основе aLRT обозначена цифрами. Шкала в количестве замен на позицию.

Выявленные с помощью гибридизации in situ пространственные паттерны экспрессии Avi-piwi1 и Avi-piwi2 в целом проявляют большую степень сходства. Однако максимальный дифференциальный сигнал мРНК Avi-piwi1 на всех проанализированных стадиях является более интенсивным, чем таковой у Avi-piwi2, что может свидетельствовать о различиях в уровне экспрессии этих генов.

Как и в случае Avi-vasa и Avi-pl10 различная по интенсивности в разных зачатках экспрессия паралогов Piwi устанавливается к стадии ранней трохофоры.

С этого момента и до стадии ранней метатрохофоры экспрессия выявляется в большинстве зачатков личинки. Относительно невысок уровень экспрессии генов Piwi в эктодермальных производных – покровном эпителии всей гипосферы, примыкающих к прототроху участках эписферы, нейроэктодерме, хетоносных мешках и стомодеуме (Рис. 39). Гораздо большую яркость сигнал имеет во внутренних (мезодермальных) структурах. Avi-piwi1 проявляет практически идентичный с Avi-vasa и Avi-pl10 паттерн экспрессии в эктомезодерме. У ранних трохофор в составе эктомезодермы хорошо отличимы крупные боковые Avi-piwi1-положительные клетки и скопление более мелких ростральных клеток, расположенных над стомодеальной пластинкой (Рис. 39 А). У более зрелых личинок формируется сплошной домен экспрессии Avi-piwi1 вокруг стомодеума (Рис. 39 Д, И).

Рис. 39. Экспрессия Avi-piwi1 (А–В, Д–Ж, И–Л) и Avi-piwi2 (Г, З, М) в начале ларвального развития. Гибридизация in situ, DIC. А–Г – ранняя трохофора (43 чпо); Д–З – средняя трохофора (59 чпо); И–М – ранняя метатрохофора (90 чпо). А, Д, И – вентральная проекция; Б, Г, Е, З, К, М – вентральная проекция, глубокая фокальная плоскость; В, Ж, Л – латеральная проекция, дорсальная сторона справа. Энтомезодерма (мезодермальные полоски) отмечена оранжевым пунктиром, экспрессия в них показана белыми стрелками, экспрессия в основании МП (во вторичном мезобласте) – прозрачным треугольником, экспрессия в эктомезодерме – оранжевыми треугольниками, экспрессия в эктодерме – синими треугольниками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума. Масштаб 25 мкм.

В пределах энтомезодермы трохофор для транскриптов Avi-piwi2 характерно более или менее равномерное распределение по длине МП (Рис. 39 Г, З). В случае же Avi-piwi1 можно говорить о преобладании экспрессии на переднем конце МП с тенденцией к ослаблению ее интенсивности в задних частях МП (Рис. 39 Б, В, Е, Ж). На стадии ранней метатрохофоры относительно сильная экспрессия паралогов Piwi приурочена к внутренним тканям по бокам гипосферы (Рис. 39 К–М). Расположение некоторых Avi-piwi1-положительных клеток вокруг хетоносных мешков практически полностью повторяет паттерн экспрессии Avi-twist в предполагаемых зачатках параподиальных мышц.

Так же как и в случае Avi-vasa один из наиболее сильных внутренних доменов экспрессии Avi-piwi1 находится на вегетативном полюсе (Рис. 39 Б, Е, К). У трохофорных личинок этот домен включает около 6–8 мелких клеток, а у метатрохофор он сильно расширяется в поперечном направлении. Тканевую принадлежность этого домена автор связывает с вторичным мезобластом (особыми клетками, происходящими от мезотелобластов).

3.2. Разработка генетических методов прижизненного и функционального анализа Важнейшим подходом к объяснению причинности феноменов развития являются экспериментальные методы. Высокоточные генетические манипуляции доступны в данный момент лишь для ограниченного числа модельных объектов. Для включения в их список нереидных полихет были предприняты исследования методической направленности. Они позволили получить качественно новый инструмент для анализа развития мезодермы у Spiralia.

3.2.1. Трансгенез на основе транспозона Mos1 Трансгенез с использованием ДНК-транспозонов был впервые опробован на P.

dumerilii К. Тессмар, Ф. Райбле и Б. Бэкфишем. Трансгены на основе транспозонов Tol2 и Minos показали относительно высокую эффективность работы в поколении G0, но в следующих поколениях экспрессия трансгена прекращалась (Backfisch, 2013). С помощью генетической репортерной конструкции на основе транспозона Mos1 были получены первые стабильные трансгенные линии P. dumerilii (Backfisch et al., 2013;

Backfisch et al., 2014). Однако для более широкого применения подобных трансгенных конструкций требовалось дополнительно проанализировать механизм транспозиции, т.е. параметры вырезания и встраивания транспозона Mos1 в геном P. dumerilii, что и было сделано в нашей работе.

Рис. 40. Вырезание трансгена на основе транспозона Mos1 из вектора в зависимости от наличия транспозазы. А – строение трансгена, цифрами обозначена длина последовательности в bp. На границах трансгена расположены терминальные повторы (Mos1 TR, красные блоки), оканчивающиеся 3’ и 5’ инвертированными повторами (ITR).

Трансген кодирует флуоресцентные маркеры dsRed и GFP (оливковые блоки) и промоторную область гена Pdu-rps9 (циановый). Б – строение вектора-донора до и после вырезания трансгена. Черные стрелки показывают положение праймеров для скрининга. В – результаты гнездовой ПЦР на зародышах, инъецированных вектором с (+ mos1) или без (– mos1) мРНК транспозазы. М – дорожка с маркером молекулярного веса 2-Log (NEB), цифрами слева обозначена длина фрагментов ДНК в bp.

Параметры вырезания транспозона из вектора-донора и активность вспомогательного фермента – транспозазы Mos1 – анализировали с помощью ПЦР. Для этого в зиготы P. dumerilii инъецировали ДНК вектора-донора pMos{rps9::egfp}frkt1074 с или без мРНК транспозазы. Через четыре часа после микроинъекций зародышей использовали в ПЦР с праймерами, комплементарными к последовательности вектора за пределами трансгена (Рис. 40 А, Б). Праймеры были подобраны так, чтобы в отсутствие транспозона (с “пустого” вектора) в ПЦР амплифицировался фрагмент длиной 388 bp. Из зародышей, инъецированных смесью с мРНК транспозазы Mos1, были получены ампликоны различной длины – от 100 до 552 bp (Рис. 40 В). В случае инъекций смесью без мРНК Mos1 продукт ПЦР отсутствовал. Этот факт подтвердил отсутствие эндогенной активности Mos1 у P. dumerilii. В случае доставки экзогенной мРНК Mos1 можно с уверенностью говорить об успешной выработке в клетках P.

dumerilii активного фермента. Варьирующая длина ампликонов, по-видимому, связана с вариабельностью места вырезания транспозона из вектора-донора.

Полученные ампликоны были клонированы и просеквенированы. Их выравнивание с последовательностью вектора (Рис. 41) показало, что, действительно, транспозон вырезается неточно, т.е. не по границам терминальных инвертированных повторов (ITR), как происходит по каноническому механизму у других модельных объектов. Из 21 просеквенированной последовательности в девяти присутствовали фрагменты транспозона, а у остальных 12-ти не хватало фрагментов вектора за пределами ITR. Кроме того, в семи ампликонах в области соединения 5’ и 3’ концов вектора были обнаружены невыравниваемые (не соответствующие какой-либо части вектора и транспозона) участки длиной 1–24 bp.

Рис. 41. Выравнивание ампликонов из ПЦР-скрининга и вектора-донора pMos{rps9::egfp}frkt1074. Цифрами наверху и слева обозначена длина последовательности в bp. Границы точно вырезаемого трансгена показаны синим пунктиром. Сохранившиеся в ампликонах полноразмерные инвертированные повторы (ITR) показаны красными блоками, их фрагменты – оранжевыми, векторная область за пределами трансгена – зелеными.

Для анализа места интеграции трансгена на основе транспозона Mos1 в геном P.

dumerilii использовались трансгенные животные из линий tuba::egfpvbci1 и ropsin::egfpvbci2. Как было показано ранее (Backfisch et al., 2013; Backfisch et al., 2014), в геноме этих животных содержится не менее одной копии трансгена, обеспечивающего экспрессию флуоресцентного белка GFP с промотора гена -тубулина или r-опсина P.

dumerilii. Для выяснения границ встроившегося транспозона на матрице гДНК трансгенных животных проводили TAIL (thermal asymmetric interlaced) ПЦР (TAIL-PCR).

Полученные ампликоны клонировали и секвенировали. Установленные последовательности выравнивали с последовательностью вектора-донора (Рис. 42).

Рис. 42. Выравнивание ампликонов гДНК из TAIL-ПЦР и вектора-донора pMos{rps9::egfp}frkt1074. Цифрами обозначена длина последовательности в bp.

Праймеры для TAIL-ПЦР показаны зелеными треугольниками, векторная область за пределами трансгена – зелеными блоками, часть ампликона, соответствующая последовательности в векторе – зеленой линией.

В случае трансгенной линии tuba::egfpvbci1 можно говорить о существовании как минимум двух сайтов интеграции, поскольку были получены ампликоны, несводимые к единой модели. В одном ампликоне трансген заканчивался за 67 bp до конца 3’ ITR, после чего следовала предполагаемая гДНК. В другом варианте ампликонов последовательность встроенного трансгена содержала векторную область, которая не менее чем на 183 bp выдавалась за границу 3’ ITR (Рис. 42). Для линии r-opsin::egfpvbci2 были получены ампликоны, реконструируемые в один вариант сайта интеграции. В этом варианте векторная часть трансгена на расстоянии 496 bp от границы 3’ ITR переходит в последовательность обширного фрагмента CDS флуоресцентного белка dsRed. Следует отметить, что идентичная последовательность dsRed является частью трансгенной конструкции, расположенной внутри транспозона (Рис. 40 А). Появление второй копии dsRed на границе встроившегося транспозона может быть объяснено существованием неканонического способа интеграции с включением более одного участка экзогенной ДНК в геномный локус хозяина.

Таким образом, важными особенностями работы транспозазы Mos1 в клетках P.

dumerilii являются вариабельность границ вырезания и встраивания транспозона, а также возможность множественной интеграции различных фрагментов в один геномный локус. Эти свойства, по-видимому, и являются причиной малой эффективности (5%) трансгенеза с использованием Mos1 (Backfisch et al., 2014).

3.2.2. Трансгенез на основе рекомбинантной BAC Генетические конструкции на основе рекомбинантной BAC (бактериальная искусственная хромосома, bacterial artificial chromosome) являются хорошо разработанной системой для трансгенеза. ВАС-клоны, из которых состоят геномные библиотеки, могут вмещать обширные фрагменты гДНК (до 150–300 kb каждый). Такие фрагменты содержат полноразмерные локусы генов, включая далеко отстоящие от кодирующей ДНК регуляторные области (энхансеры и сайленсеры). Для создания репортерного трансгена на основе BAC в CDS гена интереса внедряют, например, нуклеотидную последовательность GFP. После доставки в организм хозяина рекомбинантная ВАС обеспечивает тканеспецифичную экспрессию флуоресцентного маркера.

Стратегия нашего исследования состояла в том, чтобы создать на основе ВАСклона из геномной библиотеки A. virens репортерный трансген и проверить его работу в клетках близкородственного вида – P. dumerilii. Известно, что геном у A. virens почти вдвое меньше, чем у P. dumerilii (Zantke et al., 2014). A. virens также обладает более компактными генетическими локусами, в которых потенциальные регуляторные участки ближе расположены к CDS, чем у P. dumerilii (Ф. Райбле, личное сообщение).

Кроме того, степень дивергенции некодирующей гДНК у этих двух видов подходит для выявления эволюционно-консервативных регуляторных участков (т.н. phylogenetic footprinting) (Zantke et al., 2014). Репортеры на основе рекомбинантной ВАС A. virens не были ранее использованы для трансгенеза P. dumerilii, хотя являются многообещающими более компактными конструкциями, в особенности учитывая проблему нестабильной работы транспозаз у P. dumerilii.

В геномной ВАС-библиотека A. virens с помощью Саузерн-гибридизации было идентифицировано 9 клонов, содержащих фрагмент гена Avi-twist. После сравнения этих клонов рестрикционным анализом (Рис. 43) один из них (69М19) был просеквенирован. Полученные последовательности удалось собрать in silico в 17 контигов с общей длиной вставки (без векторной области) 140,6 kb. Контиг, содержащий локус Avi-twist составил 23,6 kb, из которых 11,4 kb находились “выше” (up-stream) 5’-конца известной кДНК.

Рис. 43. Анализ ВАС-клонов, содержащих локус гена Avi-twist. А – рестрикция 8 клонов с EcoRI, HindIII и EcoRI+HindIII (подписано сверху). Б – саузерн-гибридизация с зондом из фрагмента кДНК Avi-twist. Цифрами подписаны порядковые номера анализированных клонов, М – дорожка с маркером молекулярного веса 2-Log (NEB), шкала слева – длина в см. Звездочкой отмечены фрагменты, содержащие последовательность Avi-twist у секвенированного клона № 3 (координаты в ВАС-библиотеке 69M19): 4,6 kb + 3,2 kb (EcoRI), 11,8 kb (HindIII), что соответствует положению сайтов рестрикции в полученных контигах.

Выравнивание геномных локусов Twist A. virens и P. dumerilii по алгоритму MULAN позволило выявить в этой 5’-области контига 6 эволюционно-консервативных участков (ECR). 8 ECR находилось внутри интрона, а еще 2 ECR – “ниже” (down-stream) 3’-конца кДНК (Рис. 44). Сохранение у двух видов нереид этих ECR в некодирующей гДНК говорит в пользу их возможной функциональной значимости как регуляторных модулей. Вместе с тем, сравнение локусов Twist нереид и других беспозвоночных с просеквенированным геномом (полихета Capitella teleta, моллюск Crassostrea gigas, ланцетник Branchiostoma floridae) не позволило обнаружить ECR в некодирующей гДНК, что говорит о сильной дивергенции регуляторных областей этого гена даже среди Spiralia.

Рис. 44. Выравнивание геномных локусов Twist A. virens и P. dumerilii по алгоритму MULAN. На последовательности локуса гена Avi-twist аннотированы кодирующая часть в первом экзоне (синий блок), 5’ UTR (желтый блок) и эволюционно-консервативные участки ECR (коричневые блоки). На графике снизу отражен уровень идентичности (в процентах от 50 до 100%) нуклеотидных последовательностей A. virens и P. dumerilii на протяжении 100 bp. Цифрами внизу обозначена длина последовательности в kb.

По протоколу BAC-рекомбинации (Ejsmont et al., 2009) в CDS Avi-twist была внедрена кодирующая последовательность eGFP (enhanced GFP) и отделенная мотивом F2A последовательность нитроредуктазы. В векторную область BAC тем же путем встраивали кассету с терминальными инвертированными повторами транспозона Tol2. Успешность и правильность внедрения кассет проверялась рестрикционным анализом (Рис. 45) и секвенированием амплифицированных в ПЦР сайтов интеграции.

Рис. 45. Рестрикционный анализ (XhoI) ВАС-клона 69M19, содержащего локус гена Avitwist, на разных этапах рекомбинации. 1 – клон дикого типа, 2 – после первого акта рекомбинации, 3 – после второго акта рекомбинации, М – дорожка с маркером молекулярного веса 2-Log (NEB). Звездочками отмечены фрагменты с измененной длиной, что соответствует ожидаемому положению сайтов рестрикции после рекомбинации.

Препараты ДНК, выделенные из рекомбинантных ВАС, инъецировали в зиготы P.

dumerilii. Работа репортерной конструкции Avi-twist::eGFP-F2A-NTR была проверена с помощью конфокальной микроскопии на стадии поздней трохофоры (40 чпо).

Оказалось, что eGFP дифференциально экспрессируется в мезодермальных зачатках. В мезодермальных полосках отдельные группы eGFP-положительных клеток были метамерно организованы в виде поперечных полос в основании хетоносных мешков (Рис. 46). Наиболее интенсивным сигнал eGFP был в эктомезодермальных клетках, расположенных выше и по бокам от стомодеума (Рис. 46). Этот паттерн экспрессии трансгена соответствует картине распределения мРНК Twist у P. dumerilii и A. virens, в связи с чем можно констатировать успешность выбранного подхода. Из эксперимента следует, что гДНК использованного ВАС-клона A. virens содержит регуляторные области, достаточные для запуска тканеспецифичной экспрессии Twist. Кроме того, эти регуляторные элементы консервативны в пределах нереид, так что могут работать у близкородственных видов, таких как P. dumerilii и A. virens.

Рис. 46. Экспрессия трансгена Avi-twist::eGFP-F2A-NTR у средних трохофор P. dumerilii (36 чпо). Прижизненные наблюдения, максимальная проекция конфокального Z-стека, каналы подписаны в верхнем правом углу: eGFP (зеленый), TRITC (красный), DIC (серый). А, Б – анимальная проекция, дорсальная сторона (dors) сверху; А–З – вентральная проекция одного и того же объекта, В, Г и Д–З – 2 разные фокальные плоскости. Экспрессия еGFP в энтомезодермальных клетка показана белыми стрелками, экспрессия в эктомезодерме – оранжевыми треугольниками, Х – вегетативный полюс (область проктодеума), звездочка – область стомодеума.

Масштаб 50 мкм.

Наиболее раннюю экспрессию трансгена Avi-twist::eGFP-F2A-NTR удалось выявить на начальных этапах гаструляции P. dumerilii (9 чпо). В отличие от результатов гибридизации in situ, по которым мРНК Twist присутствует в соматобласте 4d, его дочерних клетках М и эктомезодермальных бластомерах 3a–3d, eGFP не обнаруживается в М-клетках, однако его экспрессия происходит в нескольких крупных бластомерах, предположительно эктомезодермальной природы (Рис. 47). Более детального описания ранней работы трансгена получить не удалось, что связано с малой эффективностью использованного протокола микроинъекций высокомолекулярных препаратов ВАС ДНК, приводящего к высокой смертности и большому количеству аномалий развития.

Рис. 47. Экспрессия трансгена Avi-twist::eGFP-F2A-NTR у ранней гаструлы P. dumerilii (9 чпо). Прижизненные наблюдения, максимальная проекция конфокального Z-стека, каналы подписаны в верхнем правом углу: eGFP (зеленый), TRITC (красный), DIC (серый). Масштаб 50 мкм.

3.2.3. Мутагенез с помощью нуклеаз TALEN Для получения нокаутных P. dumerilii был избран наиболее современный и эффективный метод на основе нуклеаз TALEN (Transcriptional Activator-Like Effector Nuclease) (Christian et al., 2010), в качестве гена-мишени – Pdu-twist. Анализ структуры этого гена приведен в разделе 3.1.1. Для подбора дизайна TALEN требовалось прежде всего установить сайты полиморфизма в кодирующей части гена. Для этого у девяти животных из трех инбредных линий (PIN, VIO, FL2) из гДНК была амплифицирована последовательность первого экзона Pdu-twist и последовательность, включающая оба экзона и интрон. Ампликоны, содержащие интрон не отличались по длине, которая составляла около 7 kb (Рис. 48), что соответствовало данным геномной базы. По различиям в длине интрона можно выявить разные аллели гена, однако в случае Pdutwist такого выраженного полиморфизма не наблюдалось. Амплифицированные последовательности первого экзона Pdu-twist также имели одинаковый размер (0,7 kb), поэтому шесть из них были клонированы и просеквенированы.

Рис. 48. Результаты ПЦР на гДНК P. dumerilii из инбредных линий PIN, VIO, FL2.

Ампликоны содержат первый экзон и интрон Pdu-twist, составляя во всех образцах ~7 kb, что соответствует длине последовательности из геномной базы данных. М – дорожка с маркером молекулярного веса 2-Log (NEB).

Рис. 49. Аннотированная последовательность первого экзона Pdu-twist. Фиолетовым выделены участки, кодирующие консервативные домены bHLH и WR, зеленым – позиции праймеров #2328 и #2432, коричневым, оранжевым и красным – участки, связывающие TALEN, циановым – сайты рестрикции в спейсерах TALEN, серые треугольники – позиции SNP. Цифрами обозначена длина последовательности в bp.

Сравнение установленных последовательностей первого экзона Pdu-twist выявило девять сайтов однонуклеотидного полиморфизма (SNP) (Рис. 49). Эти SNP приходились на третий нуклеотид в триплете и не изменяли аминокислотную последовательность у разных аллелей. Преобладающий вариант (пять идентичных последовательностей) был назван аллелью А, альтернативный вариант – аллелью В.

Дизайн трех пар TALEN был подобран так, чтобы избежать перекрывания с сайтами полиморфизма (Рис. 49), поскольку для эффективного связывания белков TALEN с ДНК необходимо абсолютное соответствие нуклеотидной последовательности с распознающими ее специфическими доменами. Для связывания TALEN были выбраны сайты перед последовательностью, кодирующей bHLH домен Pdu-twist, так что эффект от действия TALEN (двунитевой разрыв ДНК с последующей репарацией NHEJ и возможным сдвигом рамки считывания) нарушил бы этот функциональный домен.

Было сконструировано три пары TALEN (twi-1L/R, -2L/R, -3L/R), связывающих сайты ДНК от 13 до 17 bp с длиной спейсера от 12 до 16 bp. Клонированные последовательности TALEN были просеквенированы для подтверждения их корректности. Полученную методом транскрипции in vitro мРНК каждой пары TALEN инъецировали в зиготы P. dumerilii, после чего личинок (24 чпо) использовали для скрининга мутаций с помощью ПЦР и последующей рестрикции. Самыми эффективными мутагенами оказалась пара TALEN twi-3L/R, обладающая наиболее длинными сайтами связывания (по 17 bp каждый) и наибольшим спейсером (16 bp). По результатам ПЦР и рестрикции (Рис. 50) в 39 пробах было выявлено 20 проб с дополнительными более короткими (в 11 пробах) и/или с непереваренными (в 17 пробах) фрагментами первого экзона Pdu-twist, несущих мутации. В расчете на одного инъецированного зародыша (в каждой пробе находилась ДНК от трех объектов) вероятность получения мутации с помощью пары TALEN twi-3L/R составляет от 17% до 51%.

Рис. 50. Проверка активности TALEN twi-3L/R с помощью ПЦР на гДНК инъецированных зародышей. Дорожки а – ампликоны первого экзона Pdu-twist до рестрикции (у дикого типа – 483 bp), б – ампликоны после рестрикции с BamHI (у дикого типа – 315 bp + 168 bp), контроль – образцы из неинъецированных зародышей, М – маркер молекулярного веса 2-Log (NEB), цифрами справа обозначена длина фрагментов ДНК в bp.

Дополнительные более короткие ампликоны (с делецией) отмечены белой звездочкой, непереваренные полоски (с мутацией сайта BamHI) – двумя черными звездочками.

Клонирование и секвенирование десяти мутантных ампликонов показало наличие в них различных indel-мутаций (инсерций и делеций) (Рис. 51). Делеции охватывали фрагменты длиной 1–286 bp и во всех случаях приводили к сдвигу рамки считывания, т.е. к нокауту функционального гена. В трех случаях на фланкирующих делецию участках встречались нуклеотиды (от одного до шести), отличающиеся от последовательности дикого типа. Таким образом, можно говорить об успешности работы белков TALEN twi-3L/R, которые индуцируют двунитевой разрыв гДНК в кодирующей последовательности Pdu-twist. По-видимому, это активирует у P. dumerilii типичное для эукариот негомологичное воссоединение концов ДНК (репарацию NHEJ), что сопровождается внесением делеций и случайных нуклеотидов на месте разрыва (Wyman, Kanaar, 2006).

Рис. 51. Выравнивание ампликонов первого экзона Pdu-twist, полученных после ПЦРскрининга TALEN-индуцированных мутаций. Положение TALEN twi-3L/R показано красными блоками сверху на последовательности дикого типа (WT), рестрикционный сайт BamHI в спейсере – циановым. Несовпадающие с диким типом позиции выделены зеленым, отсутствующие нуклеотиды – знаком -, обозначение мутаций приведено слева: за префиксом - указана длина делеции в bp, перед аббревиатурой SNV (single nucleotide variant) приведено количество нуклеотидных замен.

Из дополнительных инъецированных зародышей P. dumerilii были получены половозрелые особи. В связи с высокой вероятностью получения больших (100 bp) делеций, видимых при электрофорезе, генотипирование велось c помощью ПЦР без последующей реакции рестрикции. Отбор на большие делеции позволил сократить время скрининга и значительно упростить всю процедуру. При проверке на мутацию следующего поколения (G1 – потомство инъецированных особей) в четырех из девяти прогенотипированных партий помимо ампликонов дикого типа были обнаружены дополнительные более короткие фрагменты. Ювенильные животные из этих партий (содержащих гетерозиготы Pdu-twist+/-) не проявляют фенотипических отклонений от нормы. Скрещивание гетерозигот позволит вывести данную мутацию в гомозиготное состояние и выяснить функцию гена Pdu-twist.

3.3. Активность MAP-киназного сигналинга в эмбриогенезе

3.3.1. Выявление компонентов каскада MAP-киназ В геномной и транскриптомной базе данных у P. dumerilii было найдено по одному гену-ортологу MAPKK (Mek) и MAPK1/2 (Erk1/2) – ключевых терминальных элементов MAP-киназного сигнального пути. Временной паттерн экспрессии Pdu-mapkk и Pdu-mapk1/2 на уровне мРНК был исследован с помощью полуколичественной полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР, RT-PCR).

Рис. 52. Результаты RT-ПЦР, отражающие временную динамику уровня экспрессии Pdumapkk и Pdu-mapk1/2. Цифрами на оси абсцисс обозначены стадии развития: 1 – выметанные неоплодотворенные яйца (0 чпо); 2 – начало формирования второго квартета микромеров (3,5 чпо), 3 – формирование соматобласта 4d и четвертого квартета микромеров (5 чпо), 4 – переход к билатеральному дроблению и формирование М-клеток (5,5 чпо), 5 – поздняя гаструла/протрохофора (16 чпо), 6 – ранняя трохофора (24 чпо), 7 – ранняя метатрохофора (48 чпо), 8, 9 – нектохета (72 чпо и 96 чпо). А – ампликоны Pdu-mapkk, Pdu-mapk1/2 и референсного гена Pdu-rps9 на агарозном геле. Б – график с рассчитанным относительным уровнем мРНК Pdu-mapkk (синий) и Pdu-mapk1/2 (красный).

Транскрипты обоих генов присутствуют на всех проанализированных стадиях развития, начиная с неоплодотворенного яйца и заканчивая средней нектохетой (96 чпо) (Рис. 52). С момента нереста и до конца дробления уровень экспрессии Pdu-mapkk и Pdu-mapk1/2 остается практически неизменным. На более продвинутых стадиях (поздняя гаструла/протрохофора (16 чпо), ранняя трохофора (24 чпо), ранняя метатрохофора (48 чпо) и ранняя нектохета (72 чпо)) можно наблюдать некоторое снижение относительного количества транскриптов Pdu-mapkk. В случае Pdu-mapk1/2 колебания уровня экспрессии на личиночных стадиях были менее существенны (Рис.

52).

Присутствие мРНК гомологов MAPKK и MAPK1/2 в течение эмбрионального развития P. dumerilii позволило предположить, что MAPK-сигналинг, как и при развитии ряда моллюсков, может быть задействован в спецификации мезодермы у нереид.

Поскольку этот вопрос не получил однозначного решения в исследовании на P.

dumerilii (Pfeifer et al., 2014), была предпринята попытка изучить активность MAPкиназы в раннем эмбриональном развитии A. virens.

Активация MAP-киназы, выявленная с помощью антител к фосфорилированной форме Erk1/2 (dpErk1/2), наблюдалась у A. virens со стадии восьми бластомеров. В этот момент все клетки зародыша претерпевали митоз, находясь в анафазе (Рис. 53 А–А’’).

Активная форма Erk1/2 колокализовалась с хромосомным материалом трех клеток:

микромеров 1c, 1d и макромера 1D (Рис. 53 А, Таблица 2). Эти три клетки расположены на дорсальной стороне зародыша так, что тесно контактируют друг с другом. На следующей проанализированной стадии 16-ти бластомеров (интерфаза пятого клеточного цикла) все 12 микромеров (т.е. 1q1, 1q2 и 2q), независимо от принадлежности к одному из четырех квадрантов, демонстрировали ядерную окраску на dpErk1/2 (Рис. 53 Б, Таблица 2). Напротив, во всех четырех макромерах (2A, 2B, 2C и 2D) отсутствовал сигнал dpErk1/2 (Рис. 53 Б–Б’’, Таблица 2).

Рис. 53. Распределение активной формы МАР-киназы в ходе дробления у A. virens.

Иммуноцитохимическое выявление dpErk1/2 (зеленый канал), тубулина (красный) и окраска DAPI на ДНК (синий), максимальная проекция конфокального Z-стека. Д–Д ’’ – вид с вегетативного полюса, дорсальная сторона справа; остальные – вид с анимального полюса, дорсальная сторона внизу. В каждом вертикальном столбце (A– A’’, Б–Б’’, B–B’’, Г–Г’’, Д–Д’’) представлен один и тот же зародыш, стадия развития указана сверху. Разные каналы показаны в вертикальных рядах: А–Д – антитела к dpErk1/2 (вместе с антителами к тубулину в Д–Д’’); А’–Д’ – DAPI; А’’–Д’’ – совмещение всех каналов. Бластомеры с сигналом dpErk1/2 подписаны на А–Д;

идентифицированные клетки, не проявляющие иммунореактивность к dpErk1/2, подчеркнуты на Д, А’–Г’. Стрелка указывает на полярные тельца (анимальный полюс).

Масштаб 50 мкм.

–  –  –

3.3.2. Ингибиторный анализ Для оценки функции MAPK-сигналинга в раннем развитии A. virens был поставлен эксперимент со специфическим ингибитором MAPKK – U0126 – фармакологическим агентом, блокирующим фосфорилирование MAP-киназы Erk1/2 повсеместно. Начало воздействия U0126 соответствовало периоду дробления, во время которого была обнаружена активная форма Erk1/2 – со стадий восьми, 16-ти, 17ти бластомеров и после формирования соматобласта 4d – эксперименты (I), (II), (III) и (IV), соответственно (Рис. 54). Во всех вариантах эксперимента действие блокатора было снято на стадии ранней гаструлы (20 чпо). Анализу подвергли личинок в возрасте 62 чпо, достигших в контроле стадии средней трохофоры, и средних метатрохофор (113 чпо).

Во всех экспериментах у прижизненно изученных личинок наблюдалась билатеральная симметрия тела: присутствовали правильно расположенные глаза, стомодеум, хетоносные мешки. Трохофоры плавали с помощью ресничек прототроха, однако у объектов из экспериментов (I), (II) и (III), в отличие от контроля, отсутствовал фототаксис, а также наблюдалось полное или частичное отсутствие пигмента в прототрохе. У всех метатрохофор, кроме контрольных, отсутствовали мышечные сокращения, гипосфера была несколько укорочена и иногда аномально загнута вперед.

Рис. 54. Влияние ингибитора МАРК-сигналинга U0126 на развитие мезодермы у A.

virens. А – схема экспериментов (I), (II), (III), (IV). Стадии развития подписаны на горизонтальной временной оси сверху, периоды обработки ингибитором отмечены красным. Все объекты были проанализированы на стадии средней трохофоры (крестики) и показаны на Б–Л – гибридизация in situ, DIC, вентральная проекция.

Экспрессия Avi-twist (Б–Е) и Avi-mox (Ж–Л) в разных вариантах эксперимента и контроле (подписано сверху). В результате экспериментов (I), (II), (III) энтомезодерма демонстрирует экспрессию Avi-twist и Avi-mox, но ее морфогенез существенно нарушен

– отмечено прозрачной стрелкой. В эксперименте (IV) и контроле наблюдается нормальный метамерный паттерн экспрессии – черные стрелки. Звездочка – область стомодеума. Масштаб 25 мкм.

Для более детального анализа влияния U0126 на развитие мезодермы у трохофор были изучены паттерны экспрессии мезодермальных генов-маркеров Avitwist и Avi-mox. Результаты гибридизации in situ показали, что мезодермальный материал формируется даже при самом раннем подавлении МАР-киназного сигналинга. У всех объектов из всех экспериментов с U0126 были выявлены эктомезодермальные домены экспрессии Avi-twist и Avi-mox, расположенные вблизи стомодеума. Энтомезодермальные Avi-twist-положительные и Avi-mox-положительные клетки также были обнаружены у всех личинок, однако организация этих доменов сильно отличалась в различных вариантах эксперимента по подавлению MAPKсигналинга (Рис. 54).

У личинок из экспериментов (I), (II) и (III) строение и форма МП была существенно нарушена. Вместо нормального метамерного паттерна экспрессии Avitwist и Avi-mox в энтомезодерме на вегетативном полюсе личинок наблюдались домены экспрессии в плотных клеточных конгломератах или в деформированных МП, сильно укороченных вдоль переднезадней оси (Рис. 54). У трохофоры из эксперимента (IV), в котором ингибитор U0126 применялся после деления бластомера 3D, видимых отличий в экспрессии Avi-twist и Avi-mox по сравнению с контролем отмечено не было.

Рис. 55. Сравнение длины мезодермальных полосок у трохофор A. virens в норме и после воздействия ингибитором U0126. На фото справа изображена экспрессия Avitwist в контрольном эксперименте, вентральная проекция, оранжевый треугольник – эктомезодермальный сигнал. Белой стрелкой обозначен анализированный показатель

– расстояние в микронах по срединной линии между передней и задней границей экспрессии Avi-twist в энтомезодерме. На гистограмме отмечено среднее значение длины МП (n=18) у объектов из экспериментов (I), (II), (III), (IV) и в контроле (подписано на оси абсцисс). В качестве планок погрешности приведены значения 95% доверительного интервала. Звездочкой обозначено достоверное отличие от контроля.

Длина МП в эксперименте и контроле была измерена, как показано на Рис. 55, после чего производилась статистическая обработка морфометрических данных. В норме длина МП вдоль переднезадней оси составляет в среднем 76 µ. По результатам дисперсионного анализа (ANOVA тест) было показано достоверное влияние фактора (длительность воздействия U0126) на длину МП у трохофор (p=2,9*10-24). На гистограмме (Рис. 55) можно наблюдать положительный тренд анализируемого параметра в ряду экспериментов (I)–(IV). Post-hoc тест показал, что статистически значимые различия (p0,05) отсутствуют между выборками (II) и (III), и между выборками (IV) и “контроль”. При этом длина МП у объектов из экспериментов (I), (II) и (III) достоверно отличается от таковой в контроле (она меньше на 44%, 32% и 30%, соответственно).

Таким образом, можно уверенно говорить о нарушении морфогенеза МП у A.

virens при ранней блокаде МАРК-сигналинга (критический период – до формирования соматобласта 4d). В то же время наличие экспрессии мезодермальных маркеров и билатеральной симметрии тела у экспериментальных объектов свидетельствует в пользу существования МАРК-независимых механизмов спецификации энтомезодермы и дорсовентральной оси у исследованного вида.

Глава 4. Обсуждение результатов

4.1. Молекулярные регуляторы развития мезодермы нереид и используемые методические подходы для их анализа Получение принципиально новых данных невозможно без совершенствования методов исследования. Наиболее актуальным и плодотворным подходом современной биологии развития является изучение молекулярно-генетического контроля морфогенетических процессов с помощью прижизненного и функционального анализа. Изначально определяются гены интереса, предположительно имеющие связь с изучаемым предметом. В настоящей работе было выбрано и выделено 8 таких генов (Avi-twist, Pdu-twist, Avi-mox, Avi-evx, Avi-vasa, Avipl10, Avi-piwi1, и Avi-piwi2), проведен их филогенетический анализ, выявлена экзонинтронная и доменная организация, установлена их мезодермальная тканеспецифичность.

По построенным филогенетическим схемам можно судить, что для генов нереид в целом характерна малая длина ветвей, что отражает малую степень дивергенции этих последовательностей (Kozin, Kostyuchenko, 2015; Kozin et al., 2016). Топология дендрограмм Mox, Vasa, PL10 и Piwi показывает совместную кластеризацию гомологов Spiralia, на основе чего можно предположить большее единообразие (консерватизм) их первичной последовательности и выполняемой функции. Экзон-интронная и доменная структура изученных генов проявляет большой консерватизм – присутствуют характерные для каждого семейства функциональные домены; комплексное устройство генов с множеством экзонов отвечает анцестральному для Metazoa типу организации генома (Raible et al., 2005; Putnam et al., 2007). Особенно ярко последняя характеристика прослеживается у гомологов Vasa, PL10 и Piwi, насчитывающих у A.

virens от 15 до 20 экзонов. Около 20 экзонов содержится в соответствующих генах человека и актинии Nematostella, тогда как у дрозофилы их всего 4–8.

Консерватизм кодирующей части генов, тем не менее, не обеспечивает универсальности выполняемых функций. Как выяснилось, исследованные гены интереса вовлечены в различные аспекты развития мезодермы. Значительная функциональная вариабельность присутствует и между гомологами из одного генетического семейства у разных организмов (Таблица 3). Например, у A. virens Twist является ранним панмезодермальным маркером, а у моллюсков работает только в эктомезодерме. Причины тому следует искать в вышестоящих управляющих механизмах – в наборе цис-регуляторных элементов и связывающихся с ними трансфакторах.

Таблица 3. Мезодермальные регуляторные факторы у полихет и брюхоногих моллюсков

–  –  –

Расположение генетического локуса также крайне важно в связи с существованием дальнодействующих эпигенетических факторов, хорошо описанных, например, для Hox генов (Mallo, Alonso, 2013). Известно, что Hox-связанные гены Mox и Evx находятся у P. dumerilii на той же хромосоме, что и Hox кластер, хотя и не образуют с ним тандемной группы (Hui et al., 2012). Вероятно, такое расположение гомеобокссодержащих генов Antennapedia класса сохранилось и у A. virens, что может объяснить раннюю мезодермальную экспрессию ряда этих генов наличием общего регуляторного элемента. Для изучения конкретных механизмов необходимы подходящие эмбриологические модели и надежные методики трансгенеза, которые практически отсутствуют для спиралий.

Одним из наиболее разработанных модельных объектов среди Spiralia является нереида P. dumerilii (Fischer, Dorresteijn, 2004; Zantke et al., 2014). Для этого вида получены первые постоянные линии трансгенных и нокаутных животных (Backfisch et al., 2013; Backfisch et al., 2014). Трансгенез P. dumerilii проводился на основе транспозона Mos1, особенности работы которого были проанализированы в данной работе. При этом была установлена необычная активность Mos1, выражающаяся в вариабельности границ вырезания и встраивания транспозона с возможностью множественной интеграции различных фрагментов в один геномный локус. Механизм работы Mos1 состоит во внесении двунитевого разрыва ДНК с образованием открытых 5’ и 3’-концов, что теоретически может запускать NHEJ репарацию ДНК (Bannister et al., 2014). Таким образом, полученные варианты ампликонов вектора после вырезания трансгена могли быть результатом внесенных репарацией инсерций и делеций. Тем не менее, сохранение в векторе-доноре частей терминальных повторов ITR требует дополнительного объяснения, поскольку это противоречит каноническому способу формирования белкового комплекса транспозаз на петле ДНК и вырезанию транспозона строго по концам ITR. Вероятно, имеют место различные промежуточные продукты реакции, возникающие при неполном (однонитевом) разрыве ДНК не на границе ITR (Cuypers et al., 2012).

Полученные данные помогают объяснить невысокую эффективность (5%) трансгенеза P. dumerilii с использованием Mos1 (Козин, 2013б; Backfisch et al., 2014). Вопервых, по ряду причин может нарушаться целостность трансгена, неспособного в таком случае обеспечить доставку желаемой последовательности. Во-вторых, множественная интеграция фрагментов трансгена может создать артефакты или увеличить вероятность сайленсинга конструкции эндогенными системами защиты от транспозонов. Известны и другие нежелательные особенности Mos1: для некоторых организмов описаны предпочтительные места транспозиции, например у C. elegans – это гены, кодирующие рРНК (Granger et al., 2004), нарушение работы которых может вызывать побочные эффекты. Все вышеизложенное побуждает к дальнейшему поиску более совершенных систем для доставки трансгенных конструкций в геном P. dumerilii.

Перспективным в этом отношении выглядит трансгенез на основе интегразы phiC31 (Knapp et al., 2015).

Для прижизненного анализа экспрессии генов широкое применение нашел метод создания трансгенов на основе рекомбинантных бактериальных искусственных хромосом (BAC). Этот метод рутинно используется на классических объектах биологии развития – дрозофиле, морском еже, мыши и др. (Lee et al., 2001; Narayanan, 2015).

Преимуществом рекомбинантных BAC является полнота геномного контекста, обеспечивающего экспрессию репортера. Успешное применение этой методики на P.

dumerilii было осуществлено нами впервые. В данной работе была сконструирована рекомбинантная BAC, содержащая репортер Avi-twist::eGFP-F2A-NTR. Для временного трансгенеза, повторяющего экспрессию Twist в течение личиночного периода развития, достаточна инъекция в зародыши стандартно очищенного препарата ДНК (Maxiprep).

Критическим этапом при этом является техника микроинъекций в зиготы P. dumerilii, которая обычно ведет к большому числу травмированных и аномально развивающихся зародышей.

При сравнении геномных локусов Twist нереид A. virens и P. dumerilii нам удалось выявить в некодирующей гДНК ряд эволюционно-консервативных участков (ECR). Рекапитуляцию эндогенной экспрессии Twist с гДНК A. virens в клетках P. dumerilii можно объяснить сохранением регуляторных элементов в пределах этих ECR (Kozin et al., 2014; Козин и др., 2015, 2016). Наши результаты подтверждают правильность и плодотворность выбора пары видов A. virens–P. dumerilii для сравнительного генетического анализа, способного вскрыть микро- и макроэволюционные изменения механизмов развития. Для более детального дальнейшего изучения строения регуляторной области Twist необходимо провести трансгенез с использованием отдельных ECR в качестве энхансеров и модифицировать имеющуюся рекомбинантную BAC, по-отдельности удаляя ECR. Сравнение полученных паттернов экспрессии репортера позволит определить функцию конкретных цис-регуляторных элементов и провести поиск связывающихся с ними ТФ для реконструкции вышележащих участников генетической сети.

С целью функционального анализа Twist у нереид для P. dumerilii был адаптирован метод TALEN-опосредованного мутагенеза (Backfisch et al., 2014; Козин и др., 2015). Эффективность созданных TALEN twi-3L/R к Pdu-twist в тесте in vivo составила не менее 17%, что превосходит результат многих других сконструированных для P.

dumerilii пар TALEN (Bannister et al., 2014). Дизайн TALEN пары twi-3L/R отличается относительно длинными сайтами связывания (по 17 bp каждый) и протяженным спейсером из 16 bp. Эти характеристики являются пригодными для P. dumerilii, что несколько расширяет диапазон рекомендуемых параметров. Избранный автором путь

– отбор высокоэффективных TALEN – потребовал более длительной и трудоемкой подготовки и проверки трех пар TALEN, вместо одной. Однако это позволило сократить число инъецируемых зародышей и ускорило скрининг, обеспечив надежное получение желаемого результата. Такой подход можно рекомендовать и для дальнейших работ.

Большее внимание следует уделять созданию пар TALEN, эффективных в тесте in vivo, что достигается конструированием нескольких TALEN к гену интереса и выбором наилучшего варианта. Для инъекций успешно применяли как очищенные препараты мРНК TALEN, так и высокие концентрации неочищенной после реакции транскрипции in vitro мРНК. Последнее является удобным и предпочтительным способом подготовки мРНК для доставки в зиготы P. dumerilii.

У инъецированных животных поколения G0 (мозаичных носителей мутации) и у их потомков-гетерозигот Pdu-twist+/- поколения G1 не было выявлено каких-либо видимых фенотипических отклонений от нормы. Тем не менее, подтверждение наследования мутации делает возможным дальнейший генетический анализ с целью получения гомозиготы. Животных следующих поколений различного генотипа предполагается специально проанализировать на предмет строения мышечной системы и экспрессии мезодермальных маркеров, являющихся возможными генамимишенями Pdu-twist.

4.2. Ранняя экспрессия Twist в мезодермальных бластомерах Механизмы спецификации клеточных линий в раннем эмбриональном развитии являются одним из наиболее важных вопросов современной эмбриологии. Для зародышей Spiralia очень характерна детерминативность, т.е. жесткая предопределенность судьбы бластомеров уже на стадиях дробления. При гетероквадрантном спиральном дроблении, как у нереид, с морфологической точки зрения соответствие осей тела конкретным квадрантам можно проследить уже на четырехклеточной стадии. Сегрегация одной из самых ранних клеточных линий – первичных трохобластов – завершается во время пятого клеточного цикла. Основным гипотетическим механизмом этих событий принято считать неравномерное распределение компонентов цитоплазмы яйца (ооплазматическую сегрегацию детерминантов развития).

Для моллюсков описан интереснейший способ наследования специфических мРНК в череде клеточных делений (Lambert, Nagy, 2002; Kingsley et al., 2007; Perry et al., 2015). Показано, что во время митоза разнообразные транскрипты компактно локализуются в области центриолей и перемещаются лишь в одну из дочерних клеток.

Примечательно, что подобный механизм сегрегации, ассоциированный с центриолями, ни у кого, кроме как у гастропод, не встречается. У тех же моллюсков существуют примеры и более равномерного распределения продуктов регуляторных генов. В частности мРНК Twist у Crepidula наследуется от яйца множеством бластомеров (Henry et al., 2010; Perry et al., 2015), так что отдельной мезодермальной Twist-положительной линии не возникает.

У пиявки Helobdella транскрипты Twist в ходе ооплазматической сегрегации попадают в телоплазму зиготы (Farooq et al., 2012). Установлено, что за эту специфическую локализацию мРНК Twist отвечают особые семинуклеотидные повторы ARE2, находящиеся в 3’ UTR этого гена. В ходе дальнейшего развития и мРНК и белковый продукт Twist наследуются большинством бластомеров, а преимущественно мезодермальная экспрессия Twist наблюдается лишь на стадиях сегментации (Farooq et al., 2012). В UTR исследованных генов Avi-twist и Pdu-twist элементов ARE2 обнаружено не было. Учитывая различия механизмов ооплазматической сегрегации у пиявок и полихет (Astrow et al., 1989; Dondua et al., 1997; Костюченко, Дондуа, 2000), можно предположить, что функциональные элементы ARE2 независимо возникли при дивергенции Twist Helobdella в связи с механизмами формирования телоплазмы.

Общим для гомологов Twist с материнской экспрессией, изученных у Spiralia, является наследование мРНК этого гена большинством бластомеров на ранних стадиях развития. По нашим данным в период дробления транскрипты Avi-twist, как и транскрипты Pdu-twist (Pfeifer et al., 2014), не претерпевают избирательной сегрегации в определенную клеточную линию. мРНК гомологов Twist у нереид распределяется по свободной от желтка цитоплазме, сконцентрированной на дорсальной стороне. Такой паттерн экспрессии делает неочевидной роль Twist в определении мезодермальной идентичности.

Лишь в конце спирального дробления наблюдается некоторая концентрация продукта Avi-twist в мезодермальном соматобласте 4d (Рис. 22 А). Результаты ОТ-ПЦР свидетельствуют о том, что до завершения дробления зиготической транскрипции Pdutwist не происходит (Рис. 21). Стало быть, преимущественная экспрессия Twist у нереид в бластомере 4d осуществляется либо за счет большего содержания в нем унаследованной цитоплазмы, свободной от желтка, либо за счет селективной деградации мРНК в остальных клетках.

Следует отметить, что типичным для гомологов Twist является отсутствие материнских транскриптов в яйце. У большинства организмов, в том числе моллюска Patella (Nederbragt et al., 2002), полихеты Capitella (Dill et al., 2007), книдарии Nematostella (Martindale et al., 2004), дрозофилы (Thisse et al., 1987b), нематоды Caenorhabditis elegans (Harfe et al., 1998) и лягушки Xenopus (Hopwood et al., 1989) начало (зиготической) экспрессии Twist происходит после достижения стадии бластулы или гаструлы. Очевидно, что активация экспрессии Twist у нереид во время оогенеза является вторично приобретенным признаком, по-видимому, связанным с ранней спецификацией клеточных линий при спиральном дроблении. Более того, учитывая различия во времени запуска транскрипции Twist, в строении регуляторных элементов и во внутриклеточной локализации мРНК у изученных аннелид, моллюсков, турбеллярий и брахиопод, можно с уверенностью говорить, что регуляция экспрессии и функции Twist в раннем развитии разных групп Spiralia эволюционировали независимо (Козин, Костюченко, 2016; Kozin et al., 2016). Полученные данные позволяют предположить, что у эррантных полихет, таких как нереиды A. virens и P. dumerilii, материнские продукты Twist участвуют в автономной спецификации энтомезодермы.

Появление экспрессии Avi-twist в эктомезодермальных микромерах 3a–3d на ранних этапах гаструляции отражает активацию зиготической транскрипции гена. Этот же факт подтверждается и с помощью ОТ-ПЦР на Pdu-twist, и в экспериментах по трансгенезу P. dumerilii. Довольно часто зиготическая экспрессия гомологов Twist приурочена к области бластопора. Циркумбластопоральная (т.е. организованная в виде кольца вокруг бластопора) экспрессия Twist, выявленная на стадии гаструлы у A. virens, также характерна в явном виде для книдарии, брахиоподы и ланцетника (Yasui et al., 1998; Martindale et al., 2004; Passamaneck et al., 2015). Важно, что в большинстве случаев Twist проявляет исключительную мезодермальную (а зачастую, как и Avi-twist – панмезодермальную) специфичность. Таким образом, благодаря нашему исследованию, следует признать, что Twist на сегодняшний день является наиболее ранним панмезодермальным маркером Bilateria (Kozin et al., 2016). Подобная инвариантная тканеспецифичность и неизменная функциональная связь генов семейства Twist с развитием мезодермы отражают исключительную консервативность молекулярных путей сегрегации зародышевых листков.

Наши данные всесторонне поддерживают идею, что циркумбластопоральная закладка мезодермы эволюционно первична (анцестральна) для Bilateria (Lartillot et al., 2002b; Technau, Scholz, 2003; Martindale et al., 2004). Такая позиция, однако, ставит под сомнение выделение экто- и энтомезодермы Spiralia, как зачатков, произошедших в эволюции от разных зародышевых листков. Большинство авторов склоняется ко мнению о формированию мезодермы из энтодермы (мезэнтодермы) двухслойного предка (см. разделы 1.1.1 и 1.1.2). Следует иметь в виду, что у видов с утраченным спиральным дроблением отсутствует особый дорсальный мезодермальный зачаток, эквивалентный энтомезодермальному соматобласту 4d аннелид и моллюсков. Это ведет нас к выводу о том, что энтомезодерма может представлять собой инновацию развития, характерную для группы типов Eutrochozoa (Kozin et al., 2016). По альтернативному сценарию эктомезодерма могла независимо появляться в разных таксонах Spiralia (Perry et al., 2015), что отчасти подтверждается нестабильностью ее клеточных источников в эмбриогенезе. Прояснить эту проблему мог бы более широкий в филогенетическом отношении подбор объектов исследований, у которых следовало бы проанализировать молекулярный профиль мезодермальных зачатков. Выявление общих молекулярных маркеров позволило бы установить первоначальный паттерн предка и способствовало раскрытию путей эволюционных преобразований, определивших облик ныне живущих организмов.

4.3. Молекулярное паттернирование мезодермы в ходе ларвального развития В отличие от тщательно проработанной модели транскрипционной регуляции миогенеза у мыши и дрозофилы (см. раздел 1.1.3) для представителей Spiralia загадкой остается и полный набор мезодермально-специфичных генов, и конкретная функция хотя бы одного из них. До последнего времени это было обусловлено отсутствием подходящих методик и удобных модельных объектов. На роль последних сейчас претендуют несколько видов планарий, гастропод, пиявок и нереидные полихеты. В настоящей работе у нереид были идентифицированы гомологи некоторых важных регуляторных генов, таких как Twist, Mox, Evx, Vasa, PL10, Piwi и выявили их экспрессию в производных мезодермы (Рис. 56).

Рис. 56. Морфогенез и молекулярное паттернирование мезодермы у A. virens.

Отображены только мезодермальные домены экспрессии Twist (красный), Evx (голубой), Mox (зеленый), Vasa (синий градиент), PL10 (желтый), Piwi (розовый градиент). Области перекрывания экспрессии Twist и Evx показаны фиолетовым, Twist и Mox – коричневым. Стадия развития указана под каждым изображением. А, Б – вегетативная проекция, дорсальная сторона снизу, экспрессия наблюдается в клеткахосновательницах энтомезодермы (бластомеры 4d и М) и эктомезодермы. Макромеры на дне бластопора (серая заливка) и мезодерма интернализуются в ходе гаструляции за счет обрастания эктодермой (белая заливка). Пунктиром на Б обозначены вентральный и латеральные края бластопора. В–И – вентральная проекция, анимальный полюс вверху. В – пролиферация М-клеток дает начало мезодермальным полоскам (МП), которые распространяются вперед, экспрессируя Evx (во всех клетках) и Twist (в отдельных клетках по всей длине МП). Г, Д, Ж–И – у трохофор количество мезодермальных клеток продолжает увеличиваться, МП разрастаются латерально (вдоль дорсовентральной оси). Twist и Mox экспрессируются в перекрывающихся энтомезодермальных доменах, демонстрируя метамерный билатеральный паттерн (Г, Д). Ж–И – Vasa и Piwi имеют встречно направленные градиенты экспрессии в МП, сигнал PL10 распределен по мезодерме равномерно. Е – к стадии ранней метатрохофоры домены экспрессии Twist и Mox в энтомезодерме сегрегируются и более не пересекаются. Эктомезодермальная экспрессия обозначена белым треугольником, Х – вегетативный полюс, звездочка – область стомодеума, пт – прототрох, хм – хетоносный мешок.

В ряде случаев полученные описания являются пионерными для биологии развития аннелид (Козин, Костюченко, 2016; Kozin et al., 2016). До настоящего момента мезодермальная тканеспецифичность Mox и PL10 у спиралий была известна лишь для гастропод (Hinman, Degnan, 2002; Kranz et al., 2010). Экспрессия Evx и Piwi в ларвальной мезодерме не была установлена ранее для эррантных полихет. Наши данные позволяют по-новому взглянуть на мезодермальную программу развития аннелид и ее эволюционную историю.

Согласно имеющимся данным, начиная со стадии гаструлы, энтомезодермальные производные соматобласта 4d обнаруживают у нереид динамично меняющийся во времени молекулярный профиль. У зародышей A. virens наблюдается последовательная активация экспрессии Avi-twist, Avi-evx, Avi-vasa, Avipl10, Avi-piwi1, Avi-piwi2 и, наконец, Avi-mox в развивающихся МП. На стадиях протрохофоры–ранней трохофоры транскрипты всех изученных генов дифференциально распределены в пределах частично перекрывающихся доменов.

Для Avi-twist и Avi-mox характерна исключительно мезодермальная тканеспецифичность, тогда как остальные гены интереса проявляют свою активность еще и в эктодермальных зачатках. Наблюдаемая картина сложного сочетания мезодермальных доменов экспрессии должна отражать раннюю гетерогенность недифференцированных МП. По-видимому, этот дифференциальный молекулярный статус различных областей МП является основой для дальнейшей сегрегации мезодермальных линий у более зрелых личинок. И действительно, у средних трохофор перекрывание доменов экспрессии становится значительно меньше, а у ранних метатрохофор паттерны активности гомологов Twist, Mox, Evx и вовсе не пересекаются в пределах энтомезодермы. Несколько иначе происходит индивидуализация паттернов экспрессии гомологов Vasa, PL10, Piwi: к стадии ранней метатрохофоры уровень их активности заметно снижается; встречно направленные вдоль МП градиенты экспрессии Avi-piwi1 (переднезадний) и Avi-vasa (заднепередний) затухают;

появляются признаки метамерности сигнала с его наибольшей интенсивностью в доменах, частично или полностью повторяющих экспрессию Avi-twist.

Таким образом, очевидно, что динамика экспрессии избранных генов интереса отражает прогрессивную детерминацию различных мезодермальных зачатков. Эта пространственная неоднородность вдоль переднезадней оси МП может быть продемонстрирована экспрессией Avi-piwi1 и Avi-vasa. Различная судьба клеток МП вдоль дорсовентральной оси, вероятно, обуславливается размежеванием областей активности Avi-twist (экспрессируется в латерально расположенных зачатках параподиальных мышц) и Avi-mox (преобладает на вентральной стороне на месте развития косых мышц и/или целомических мешков). Весьма похожий переход от перекрывающихся к неперекрывающимся паттернам экспрессии Twist и Mox происходит в развитии ланцетника (Yasui et al., 1998; Minguilln, Garcia-Fernndez, 2002) и брахиоподы (Passamaneck et al., 2015). У морского ежа, по-видимому, аналогичный процесс сегрегации мезодермальных зачатков начинается уже на стадии ранней гаструлы (Andrikou et al., 2013). Примечательно, что специфичность регуляторных генов-участников у зародышей иглокожих мало сопоставима с тем, что наблюдается у спиралий (к примеру, транскрипты Twist выявляются в целомических мешках, а Mox и вовсе не экспрессируется в мезодерме). Следовательно, создание таксонспецифичного набора мезодермальных зачатков могло идти независимо в разных филогенетических линиях с привлечением различных управляющих генов.

Однако в целом среди этих регуляторных генов прослеживается определенное единообразие:

одни и те же мезодермальные факторы зачастую используются дальнеродственными организмами. При этом максимальное сходство специфичности наблюдается сразу после обособления мезодермы (во время гаструляции) и при сравнении наиболее медленно эволюционировавших, т.е. наиболее древних, таксонов (антозои среди книдарий, эррантные полихеты среди аннелид, головохордовые среди хордовых и т.д.).

Хотя конкретные молекулярные механизмы спецификации различных мезодермальных клеточных типов у Spiralia пока далеки от понимания, помимо выявленных нами и других известных молекулярных маркеров важным компонентом сети должны быть системы межклеточной сигнализации. Именно с помощью сигналинга в пределах МП может быть создан набор неповторимых регуляторных состояний, ответственных за дифференцировку разных мезодермальных производных.

Описанные нами паттерны являются и отражением и причиной возникновения уникальных последовательных состояний клеток.

Сравнение паттернов активности изученных здесь гомологов Twist, Mox, Vasa, PL10 и Piwi у нереид и других представителей Spiralia (разделы 1.1.4, 1.1.5, 1.2.3) приводит к выводу, что эти гены являются консервативными участниками мезодермальной генетической регуляторной сети. Обширные данные о роли семейств Twist и Mox в развитии животных говорят о том, что они стали управлять формированием мезодермы со времен ее появления. Анцестральный паттерн экспрессии Twist и Mox вокруг бластопора, обнаруженный у книдарий, следует признать важной предпосылкой закладки мезодермы в этой области.

Циркумбластопоральная экспрессия Twist сохранилась в раннем развитии многих животных из всех трех основных ветвей Bilateria: у Spiralia (=Lophotrochozoa) – нереида A. virens (Kozin et al., 2016), брахиопода Terebratalia transversa (Passamaneck et al., 2015), у Ecdysozoa – дрозофила (Leptin, 1991), жук Tribolium castaneum (Sommer, Tautz, 1994;

Handel et al., 2005), у Deuterostomia – ланцетник (Yasui et al., 1998). Обычно Mox активируется на более продвинутых постгаструляционных стадиях, маркируя обширные клеточные территории. Материнская экспрессия Mox с последующим избирательным наследованием продуктов гена не была показана ни для одного изученного объекта. Зиготическая экспрессия Avi-twist и Avi-mox у ранних личинок проявляет большую степень сходства, будучи локализованной в гипосфере вокруг области стомодеума (заместившего бластопор).

Спереди и по бокам от материала передней кишки – стомодеальной пластинки

– располагаются эктомезодермальные клетки, экспрессирующие Avi-twist, Avi-mox, Avivasa, Avi-pl10, Avi-piwi1, Avi-piwi2. По большей части эктомезодермальные домены экспрессии этих генов значительно перекрываются или вовсе идентичны на проанализированных стадиях. Несколько позже остальных генов проявляется активность Avi-mox. Тот факт, что специфичность выявленных мезодермальных маркеров (за исключением Avi-evx) распространяется как на энто-, так и на эктомезодерму, говорит о высокой степени сходства молекулярного статуса этих зачатков. И у большинства других Spiralia (а именно, у полихет, планарии и брахиоподы) гомологи Twist экспрессируются и в ассоциированной с передней кишкой эктомезодерме, и в мезодерме туловища (Dill et al., 2007; Martn-Durn et al., 2010;

Pfeifer et al., 2013; Passamaneck et al., 2015). Стало быть, существующее подразделение мезодермы спиралий, вероятнее всего, – вторично приобретенный признак, связанный с разделением функций частей тела вдоль переднезадней оси. Эктомезодерма, т.е.

передняя (головная) часть мезодермы, специализировалась в ходе эволюции на производство мышц головы и глотки, а энтомезодерма – задний (туловищный) домен мезодермы – обеспечивал построение локомоторной мускулатуры и целомов.

Примечательным для Twist гастропод Patella и Crepidula является исключительно эктомезодермальная экспрессия (Nederbragt et al., 2002; Perry et al., 2015). Вероятно, отсутствие энтомезодермальной активности здесь связано с сильной модификацией мышечной системы тела моллюсков. С другой стороны, гомолог Twist брахиоподы Terebratalia, как и в случае полихет, экспрессируется на поздних личиночных стадиях в клетках, ассоциированных с хетоносными мешками (Passamaneck et al., 2015). Это обстоятельство и представления о хитиновых щетинках, как о синапоморфии клады Spiralia, позволяют предположить для Twist спиралий наличие консервативной роли в паттернировании особых, связанных с хетами, мышц, обеспечивающих локомоцию планктонных личинок (Козин и др., 2016; Kozin et al., 2016).

Проанализированные в нашей работе гомологи Vasa, PL10 и Piwi проявили достаточно широкую тканеспецифичность, включающую ряд мезодермальных производных. В целом это согласуется с результатами, полученными на других спиралиях (см. раздел 1.2.3). У широко спектра животных гены GMP чрезвычайно важны для развития первичных половых и стволовых клеток, поддерживая их недифференцированное состояние. Наши данные не позволяют считать Vasa, PL10 и Piwi у A. virens исключительно маркерами ППК, хотя их экспрессия в предполагаемой популяции этих клеток (вторичном мезобласте) особенно сильна. Транскрипты генов GMP у спиралий обычно не сегрегируются в ходе дробления в определенные клеточные линии, этого не наблюдалось и у A. virens. Относительно интенсивная и продолжительная мезодермальная экспрессия Avi-vasa, Avi-pl10, Avi-piwi1 и Avi-piwi2 может быть объяснена, с одной стороны, тем что ППК аннелид ведут свое происхождение именно от мезодермального соматобласта 4d (Goto et al., 1999a; Kang et al., 2002; Rebscher et al., 2007; Dill, Seaver, 2008; Meyer et al., 2010; Rebscher et al., 2012). Однако у Capitella 4d дает ППК, но не является источником мезодермальных полосок, в которых присутствует дифференциальная экспрессия нескольких генов GMP.

С другой стороны, экспрессия гомологов Vasa, PL10 и Piwi может отражать длительное пребывание мезодермы в малодифференцированном состоянии. Созревание мышц из МП у нереид происходит со стадии средней трохофоры в переднезаднем направлении (Fischer et al., 2010; Козин и др., 2016). В этот период Avi-vasa слабее экспрессируется на переднем конце МП, где начинают дифференцироваться дорсальные и вентральные продольные мышцы, выявляемые фаллоидином. Там же, в материале первого ларвального сегмента во время развития трохофоры раньше и масштабнее экспрессируются Avi-twist и Avi-mox, что по нашему мнению связано с опережающим созреванием передних сегментов.

Таким образом, можно заключить, что гены Avi-vasa, Avi-pl10, Avi-piwi1 и Avipiwi2 дифференциально экспрессируются в зачатках, принадлежащих разным зародышевым листкам, клетки которых слабо дифференцированы и вовлечены в активные морфогенетические процессы развития A. virens (Козин, Костюченко, 2012).

Анализ работы Avi-evx, который преимущественно экспрессируется в эктодермальных доменах, позволяет предположить, что этот фактор в основном принимает участие в создании позиционной информации и регуляции клеточного поведения, нежели контролирует спецификацию каких-либо зачатков. Наиболее ранний сигнал мРНК Avi-evx выявляется на завершающих этапах гаструляции на дорсовегетативной стороне протрохофор. У трохофорных личинок Avi-evx маркирует в эктодерме гипосферы дорсальную и боковые границы интернализуемых тканей (т.е.

погружаемых внутрь зародыша зачатков передней и задней кишки), которые замещают бластопор. Сходный эктодермальный паттерн Evx описан у трохофор P.

dumerilii (de Rosa et al., 2005), однако мезодермальной экспрессии здесь выявлено не было, по-видимому, в связи с недостаточным анализом ранних стадий развития. В энтомезодерме Avi-evx широко экспрессируется лишь на ранних этапах формирования МП, когда они активно продвигаются между дорсо-латеральной эктодермой и массой макромеров в переднем направлении (Kozin et al., 2016). Таким образом, Avi-evx проявляет активность в клетках задней (дорсальной) виртуальной границы бластопора.

На поверхности зародыша эти клетки непрерывно конвергируют с боковых сторон на вентральную, где формируется вегетативная пластинка. Под эктодермальными клетками дорсальную губу бластопора у нереид занимает материал энтомезодермы, в ходе морфогенетического перемещения которого также активен Avi-evx. Лишь на продвинутых стадиях (ранняя метатрохофора) Avi-evx экспрессируется в отдельных группах клеток в составе нейроэктодермы и вблизи хетоносных мешков, что указывает на возможное участие этого гена в цитодифференциации.

Среди спиралий помимо эктодермальной, мезодермальная специфичность Evx описана для полихеты Capitella и пиявки Helobdella (Song et al., 2002; Seaver et al., 2012).

У этих аннелид сигнал мРНК Evx маркирует все энтомезодермальные клетки на самых ранних этапах формирования МП. Позднее мезодермальная экспрессия Evx исчезает у зародышей Helobdella и A. virens, но сохраняется в случае одного из двух гомологов Evx у Capitella. У других животных мезодермальная активность Evx описана, например, для дрозофилы и рыбки Danio (Frasch et al., 1987; Joly et al., 1993). Примечательно, что у обоих видов экспрессия Evx запускается под влиянием сигнальных молекул BMP/dpp и Wnt/wg (Knirr, Frasch, 2001; Pyati et al., 2005; Seebald, Szeto, 2011) и приурочена к антинейральной стороне тела, т.е. дорсальной у дрозофилы и вентральной у Danio.

Вентральная мезодерма позвоночных специфицируется весьма рано, еще до начала гаструляции, и Evx играет в этом процессе одну из ведущих ролей. Напротив, у артропод Evx участвует в гораздо более позднем и узкоспециализированном процессе паттернирования дорсальной мезодермы, а именно: клеток-предшественников сердечнососудистой системы и дорсальных мышц (Knirr, Frasch, 2001; Vargas-Vila et al., 2010). По-видимому, это позднее подключение Evx к развитию дорсальных мезодермальных тканей у насекомых связано, во-первых, с ранней детерминацией дорсовентральной оси за счет эволюционно нового Dorsal-зависимого механизма, ослабившего значение встречных градиентов агонистов и антагонистов BMP/dpp и, вовторых, с пространственной удаленностью сигнала BMP/dpp от зачатка мезодермы (вентральной бороздки). Недавно выяснилось, что BMP/dpp сигналинг участвует в дорсовентральной поляризации и у аннелид (Denes et al., 2007; Kuo, Weisblat, 2011). В соответствии с имеющимися данными логично предположить, что BMP/dpp сигналинг у нереид также запускает транскрипцию Evx, который обеспечивает дорсо-каудальную идентичность эктодермальных и мезодермальных клеток.

Известной закрепленной функцией гомологов Evx у насекомых является создание периодического паттерна вдоль переднезадней оси, т.е. сегментация (Damen, 2007). Однако у спиралий такой функции Evx не усматривается, поскольку метамерность паттерна если и появляется, то локально, чаще на стадиях с уже выраженной морфологической сегментацией. Метамерность паттерна экспрессии Evx приурочена к нейроэктодерме у Capitella, нереид A. virens, P. dumerilii и пиявки Helobdella, к латерально расположенным группам клеток, ассоциированных с хетоносными мешками у Capitella и A. virens, а также к дорсальной мезодерме у Capitella (Song et al., 2002; de Rosa et al., 2005; Seaver et al., 2012; Kozin et al., 2016).

Таким образом, наши данные полностью согласуются с концепцией эволюционно позднего вовлечения Evx и других т.н. генов правила парности (pair-rule genes) в программу развития сегментов (артропод).

В связи с проблемой сегментации мезодермы аннелид автором получены оригинальные и весьма ценные сведения. В ходе развития энтомезодермальные паттерны активности гомологов Twist, Mox, Vasa и Piwi метамеризуются в гипосфере трохофоры A. virens. Это говорит о повторяющейся гетерогенности МП вдоль переднезадней оси уже на ранних личиночных стадиях. Единственными ранее известными генами с более или менее метамерной экспрессией у полихет на подобных стадиях развития являются несколько членов NK кластера у нереиды P.

dumerilii (Saudemont et al., 2008). Для других гомеобокс-содержащих генов – Engrailed, Gbx и некоторых Hox – хорошо описана посегментная экспрессия в виде поперечных полос в пределах эктодермы трохофор P. dumerilii (Prud’homme et al., 2003; Steinmetz et al., 2011). В целом эти молекулярные данные указывают на скрытую метамерную организацию первичной трохофорной личинки полихет, что является важным и в определенной степени новым аргументом для воссоздания эволюционных событий.



Pages:     | 1 || 3 |



Похожие работы:

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБОУ ВО "СГУ имени Н.Г. Чернышевского" Биологический факультет Рабочая программа дисциплины Биология индивидуального развития Направление подготовки 44.03.01 Педагогическое образование Профиль подготовки Биология Квалификация в...»

«Научный журнал “Экономика Украины”. — 2015. — 7 (636) ПРОБЛЕМЫ ЭКОНОМИЧЕСКОЙ ТЕОРИИ УДК 368:63(477.42) А. Н. В И Л Е Н Ч У К, доцент, кандидат экономических наук, докторант, доцент кафедры финансов и кредита Житомирского национального агроэкологического университета ТЕОРЕТИКО МЕТОДОЛОГИЧЕСКИЕ ПРИНЦИПЫ ИССЛЕДОВАНИЯ СТРАХОВАНИЯ...»

«Штумпф Дарья Сергеевна СПИРОХЕТОЗ КУР (МОРФОБИОЛОГИЧЕСКИЕ АСПЕКТЫ И ЛЕЧЕНИЕ) 03.02.11 – паразитология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата ветеринарных наук Ставрополь – 2010 Работа выполнена на кафедре паразитологии и ветеринарно-санитарной экспертизы ФГОУ ВПО "Ставропольский государственный аграрный университет" Научный руководитель: доктор ветеринарн...»

«Труды БГУ 2010, том 4, выпуск 2 Обзоры УДК 582.57:236:581.19:581.522.4 ПАЖИТНИК ГРЕЧЕСКИЙ (TRIGONELLA FOENUM GRAECUM L.) КАК ИСТОЧНИК ШИРОКОГО СПЕКТРА БИОЛОГИЧЕСКИ АКТИВНЫХ СОЕДИНЕНИЙ Е.Д. Плечищик, Л.В. Гончарова, Е.В. Спиридович, В.Н....»

«УДК 622.23:504.3.054 © Т.И. Долгова, И.Г. Миронова, А.В. Павличенко ЭКОЛОГИЧЕСКАЯ ОЦЕНКА СОСТОЯНИЯ РАСТЕНИЙ ПРОИЗРАСТАЮЩИХ В ЗОНЕ ВЛИЯНИЯ ВЫБРОСОВ ЖЕЛЕЗОРУДНЫХ ШАХТ Выполнены исследования состояния растений произрастающих на территориях прилегающих к железорудному комбинату. Установлены закономерности изменения степени повреждения о...»

«Фауна и экология птиц подмосковья Труды Программы "Птицы Москвы и Подмосковья", Том 6, 2010 Научно-исследовательский Зоологический музей МГУ Труды Программы "Птицы Москвы и Подмосковья" Том 6 Фауна и экология птиц подмосковья Редакторы тома: М.В. Калякин, О.В. Волцит Редколле...»

«Разведение редких видов: джейрана, кулана, лошади Пржевальского в Экоцентре Джейран“ и развитие экологического туризма Солдатова Н.В. Зам. дир. по НИР Экоцентр "Джейран", Узбекистан В Экоцентре Джейран, не только удалось добиться разведения редких видов животных, создат...»

«ЛЕКЦИЯ № 1. Современное представление об инфекционных болезнях. Вакцинация. Календарь прививок, осложнения после вакцинации 1. Инфекционные болезни Это обширная группа заболеваний человека, вызванных патогенными вирусами, бактериями и простейшими. Суть инфекционных болезн...»

«DEFRO-RU – ІНСТРУКЦІЯ ОБСЛУГОВУВАННЯ TECH Декларація згідності для командоконтролерів ST-DEFRO-RU № 34/2010 Ми, фірма ТЕХ (TECH), вул. С. Баторія 14, 34-120 Aндрихув, з повною відповідальністью заявляємо, що нами виготовляємі терморегулятори DEFRO-RU 230V, 50 Гц виповн...»

«Положение о взаимодействии аварийно спасательных служб министерств, ведомств и организаций на море и водных бассейнах России (утв. МЧС РФ 21.06.1995, Минобороны РФ 18.04.1995, Минтрансом РФ 29.03.1995, Минтопэнерго РФ 15.03.1995, МВД РФ 31.03.1995, Минприроды РФ 25.01.1995, Росгидрометом 24.01.1...»

«References !. K ontseptsia doigosrochnogo socialno-econom icheskogo rasvitia R ossiiskoi Federtsii na period do 2020 goda: [Electronic resource] // Access mode: http://ww w. economy, gov. ru/w ps/w cm /connect/6971748040c ff24ab6a6f739669f5cbl/rasp_2008_N 1662_red_08 08...»

«30.07.-03.08.12 Подготовлено Департаментом маркетинга ЗАО "Колакс-М" Оглавление 1. МСХ РФ..3 2. КОЛАКС..4 3. Регионы..5-7 4. Мероприятия..8 5. Технологии..9 6. Новое (фермы, производства, оборудование и т.д.).10 7. Конкурсы..11 8. Зарубежье..12 9. Интерес...»

«Библиография 1. Фомин В. Отар Иоселиани // Пересечение параллельных. М., 1976.2. Левченко Я. Тенгиз Абуладзе: поэзия цвета и тоски. URL: http:// www.cinematheque.ru/post/138964/print/ (дата обращения: 03.05.2011).3. Квас...»

«Анализ результатов государственной итоговой аттестации учащихся за 2013-2014 учебный год. В соответствии с Законом образовании РФ, Уставом МБОУ СОШ №1 с. Арзгир, Порядком проведения государственной итоговой а...»

«Протокол совещания Банка России по вопросу автоматизации сдачи отчетности страховых организаций Короп Станислав Викторович Координатор Структурное подразделение Департамент сбора и обработки отчетности некредитных Банка России (далее – финансовых организаций, Департамент страхового...»

«ДЕПАРТАМЕНТ ОБРАЗОВАНИЯ ГОРОДА МОСКВЫ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБЩЕОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ГОРОДА МОСКВЫ "ШКОЛА № 2031" (ГБОУ ШКОЛА № 2031) 111675, г.Москва, ул.Дмитриевского, д....»

«ИННОВАЦИОННОЕ И УСТОЙЧИВОЕ РАЗВИТИЕ Туманова Е.А., к.э.н., и.о. доцента, 502.34+502.36 Униятова О.А., асистент, Национальная академия природоохранного и курортного строительства ПРИНЦИПЫ ОСУЩЕСТВЛЕНИЯ ЭКОЛОГИЧЕСКОГО СТРАХОВАНИЯ Экологич...»

«270 ЕКОНОМІКА ПРИРОДОКОРИСТУВАННЯ ТА ОХОРОНИ НАВКОЛИШНЬОГО СЕРЕДОВИЩА Светлана В. Шарыбар ФОРМИРОВАНИЕ РАЦИОНАЛЬНОЙ СОЦИАЛЬНО-ЭКОЛОГОЭКОНОМИЧЕСКОЙ ИНВЕСТИЦИОННОЙ ПОЛИТИКИ СЕЛЬСКОХОЗЯЙС...»

«ПРОМЫСЛОВО-БИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА PERCA FLUVIATILIS L. В ВОДОЕМАХ ВОЛГО-КАСПИЙСКОГО РЫБОХОЗЯЙСТВЕННОГО ПОДРАЙОНА В. П. Аббакумов, Е. В. Хмель, Т. В. Югай ФГБНУ "Каспийский научно-исследовательский институт рыбного хозяйства" 414056, Россия, г. Астрахань, ул. Савушкина, 1 kaspiy-info@mail.ru Ра...»

«Центрально-Азиатский научно-практический журнал по общественному здравоохранению Международный Экспертный Совет International Advisory Board 1. Жак Акар 1. Jacques Acar Посол Франции Международной Программы Ambassador for France, American Society for Microbiology Американского Общества М...»

«МКОУ "Новорычанская ООШ" ДО Дидактические игры по экологии для детей старшей группы.Составила: воспитатель старшей группы Нурманова А.К. 2014г. Дидактическая игра "Рисуем птиц". Дидактическая задача. Учить воссоздавать целостный образ животно...»

«NV-100 NV-102 Руководство по эксплуатации, версия 1.1 (09.2013) Медиацентр _ Версия документа Дата выпуска Содержание изменений Версия 1.1 20.09.2013 Изменения: 4.3 HD-TV Версия 1.0 03.07.2013 Первая публикация Версия прогр...»

«МИНОБРНАУКИ РОССИИ ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ОБРАЗОВАНИЯ "ВОРОНЕЖСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ" БОРИСОГЛЕБСКИЙ ФИЛИАЛ (БФ ФГБОУ ВО "ВГУ")...»

«ПОВОЛЖСКИЙ ЭКОЛОГИЧЕСКИЙ ЖУРНАЛ. 2017. № 1. С. 14 – 23 УДК 575.174.015.3:599.323.4:591.9(470.62) К ВИДОВОМУ СОСТАВУ, РАСПРОСТРАНЕНИЮ И ЭКОЛОГИИ ПОЛЁВОК (MAMMALIA, CRICETIDAE, MICROTINA) СЕВЕРО-ЗАПАДНОГО КАВКАЗА А. Е. Ба...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБОУ ВПО "ТУВИНСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ" КЫЗЫЛСКИЙ ПЕДАГОГИЧЕСКИЙ ИНСТИТУТ Кафедра педагогики и методики дошкольного и начального образования Роль театрал100€анных игр в экологическом воспитании старших дошкольников по спеЕжиън...»









 
2017 www.book.lib-i.ru - «Бесплатная электронная библиотека - электронные ресурсы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.